{-# OPTIONS -O2 -optc-O2 -optc-ffast-math -fbang-patterns -fexcess-precision #-} -- -- The Computer Language Benchmarks Game -- http://shootout.alioth.debian.org/ -- -- Contributed by Don Stewart -- A lazy bytestring solution. -- -- Add: -- -optc-mfpmath=sse -optc-msse2 -- import System.Environment import Data.Word import Control.Arrow import qualified Data.ByteString.Lazy as L import qualified Data.ByteString.Lazy.Char8 as C (pack,unfoldr) import qualified Data.ByteString as S import Data.ByteString.Base main = do n <- getArgs >>= readIO . head writeFasta "ONE" "Homo sapiens alu" (n*2) (L.cycle alu) g <- unfold "TWO" "IUB ambiguity codes" (n*3) (look iubs) 42 unfold "THREE" "Homo sapiens frequency" (n*5) (look homs) g ------------------------------------------------------------------------ -- -- lazily unfold the randomised dna sequences -- unfold l t n f !g = putStrLn (">" ++ l ++ " " ++ t) >> unroll f g n unroll :: (Int -> (Word8, Int)) -> Int -> Int -> IO Int unroll f = loop where loop r 0 = return r loop r i = case S.unfoldrN m (Just . f) r of (s, Just r') -> do S.putStrLn s loop r' (i-m) where m = min i 60 look ds !k = let (d,j) = rand k in (choose ds d, j) choose :: [(Word8,Float)] -> Float -> Word8 choose [(b,_)] _ = b choose ((b,f):xs) p = if p < f then b else choose xs (p-f) ------------------------------------------------------------------------ -- -- only demand as much of the infinite sequence as we require writeFasta label title n s = do putStrLn $ ">" ++ label ++ " " ++ title let (t:ts) = L.toChunks s go ts t n where go ss !s !n | l60 && n60 = S.putStrLn l >> go ss r (n-60) | n60 = S.putStr s >> S.putStrLn a >> go (tail ss) b (n-60) | n <= ln = S.putStrLn (S.take n s) | otherwise = S.putStr s >> S.putStrLn (S.take (n-ln) (head ss)) where !ln = S.length s !l60 = ln >= 60 !n60 = n >= 60 (l,r) = S.splitAt 60 s (a,b) = S.splitAt (60-ln) (head ss) ------------------------------------------------------------------------ im = 139968 imd = 139968 ia = 3877 ic = 29573 rand :: Int -> (Float, Int) rand seed = (newran,newseed) where newseed = (seed * ia + ic) `rem` im newran = fromIntegral newseed / imd ------------------------------------------------------------------------ alu = C.pack "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ \GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ \CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ \ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ \GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ \AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ \AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" iubs = map (c2w *** id) [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02) ,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02) ,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)] homs = map (c2w *** id) [('a',0.3029549426680),('c',0.1979883004921) ,('g',0.1975473066391),('t',0.3015094502008)]