May 2011 - Haskell-Cafe

I cannot find the module Data.Numbers.Primes
by KC 17 May '11

17 May '11

-- -- Regards, KC

3 3

Master Thesis on Haskell
by Burak Ekici 17 May '11

17 May '11

Dear All, I am planning to write a master thesis project on the monadic programming manner of Haskell PL. What I want to kindly ask you is that if you have enough time and patience which can be shared with me, could you please have a quick look at the attached outline for the project I intend to write. Your ideas and comments are valuable for me and I would be very appreciated if you share them. Thanks a lot and best of regards, Burak Ekici.

1 1

Options to reduce memory use (Shootout Benchmark)
by Thorsten Hater 17 May '11

17 May '11

Hello, over the weekend I played a little with the fasta benchmark at the shootout site. I tried to understand the current submission and decided to build my own version. Astonishingly, after some tuning its quite fast (<1sec on my machine, when the current entry use ~11sec) but uses quite some memory (~11MB). Basically you have to use a custom pseudo random number generator to build strings of randomized DNA by choosing from a given probability distribution. Is there some way to reduce memory consumption? 11MB seems quite a lot. Thorsten {-# LANGUAGE BangPatterns #-} module Main where import System.Environment import qualified Data.ByteString.Lazy as L import qualified Data.ByteString.Lazy.Char8 as C (pack, take) import qualified Data.ByteString as S data P = P !Char !Float type LUT = [P] alu = C.pack "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ \GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ \CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ \ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ \GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ \AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ \AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" iubs, homs :: LUT iubs = cdf [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02) ,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02) ,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)] homs = cdf [('a',0.3029549426680),('c',0.1979883004921) ,('g',0.1975473066391),('t',0.3015094502008)] -- compile LUT from assoc list cdf :: [(Char,Float)] -> LUT cdf ls = reverse $! cdf' [] 0 ls where cdf' acc _ [] = acc cdf' acc c ((v,k):ls) = cdf' ((P v c'):acc) c' ls where !c' = k + c -- extract Char from List by Key choose :: LUT -> Float -> Char choose lut !f = choose' lut where choose' ((P v k):ls)| f <= k = v | otherwise = choose' ls -- PRNG im, ia, ic :: Int im = 139968 ia = 3877 ic = 29573 data R = R !Float !Int imd :: Float imd = fromIntegral im rand :: Int -> R rand seed = R newran newseed where newseed = (seed * ia + ic) `rem` im newran = (fromIntegral newseed) / imd -- /PRNG -- Cache all possible results cache :: LUT -> L.ByteString cache ls = C.pack $! reverse $! go [v] s where (R !f !s) = rand 42 -- if we arrive at Seed 42, we completed one cycle, STOP !v = choose ls f go :: String -> Int -> String go acc 42 = acc go acc !q = go (v':acc) s' where (R !f' !s') = rand q !v' = choose ls f' -- FASTA writer from current entry fasta n s = do let (t:ts) = L.toChunks s go ts t n where go ss s n | n == 0 = return () | l60 && n60 = S.putStrLn l >> go ss r (n-60) | n60 = S.putStr s >> S.putStrLn a >> go (tail ss) b (n-60) | n <= ln = S.putStrLn (S.take n s) | otherwise = S.putStr s >> S.putStrLn (S.take (n-ln) (head ss)) where ln = S.length s l60 = ln >= 60 n60 = n >= 60 (l,r) = S.splitAt 60 s (a,b) = S.splitAt (60-ln) (head ss) main = do n <- getArgs >>= readIO . head putStrLn ">ONE Homo sapiens alu" fasta (n*2) $! L.cycle alu putStrLn ">TWO IUB ambiguity codes" fasta (n*3) (L.cycle $! cache $! iubs) putStrLn ">THREE Homo sapiens frequency" fasta (n*5) (L.drop (fromIntegral (n*3) `mod` 139968) $! L.cycle $! cache homs)

1 0

Accelerate package (CUDA). How to actually create an array?
by Grigory Sarnitskiy 17 May '11

17 May '11

Hello! I'm probing CUDA with Haskell, accelerate package to be exact. Sound stupid, but I couldn't find how to actually construct an array, for example Vector Float. There is quite a number of examples provided with the package, but they seem not simple enough for me just to start.

4 4

Inconsistent window updates with SDL library
by Michael Serra 17 May '11

17 May '11

Greetings Haskellers, I'm relatively new to the language and I'm writing a basic game of life simulation to try out the SDL bindings. The program updates the window with the next generation of cells each time you press 'n', and the problem I'm finding is that every so often the window stops updating. The program continues; refreshing the window (by moving it, say) updates it to the correct current state. I thought there must be a big problem with my code, but found the same behavior with lesson 20<https://github.com/snkkid/LazyFooHaskell>of the SDL lazyfoo tutorials (the animation test). Can anyone explain what is causing this? I hope to hear I've made some obvious mistake, rather than discover any limitation with the useful SDL bindings..

2 2

generic putback
by Sergey Mironov 17 May '11

17 May '11

Hi Cafe. I wonder if it is possible to write a IO putback function with following interface putback :: a -> IO a -> IO a putback x io = ??? where io is some action like reading from file or socket. I want putback to build new action which will return x on first call, and continue executing io after that. Thanks in advance! Sergey.

3 3

ErrorT vs Either
by Gracjan Polak 17 May '11

17 May '11

Hi all, A why question: Why: Control.Monad.Error Prelude> runErrorT (fail "msg") :: IO (Either String Int) Left "msg" but Control.Monad.Error Prelude> (fail "msg") :: (Either String Int) *** Exception: msg ? -- Gracjan

6 9

>>= definition for list monad in ghc
by Michael Vanier 16 May '11

16 May '11

Usually in monad tutorials, the >>= operator for the list monad is defined as: m >>= k = concat (map k m) -- or concatMap k m but in the GHC sources it's defined as: m >>= k = foldr ((++) . k) [] m As far as I can tell, this definition is equivalent to the previous one (correct me if I'm wrong), so I was wondering why this definition was chosen instead of the other one. Does anybody know? Thanks in advance, Mike

6 9

Problems with high-level interface to LLVM
by Николай Кудасов 16 May '11

16 May '11

Hi there, I use llvm package for building compiler for a small C-like language and it have some problems with high-level interface that package provides. I use simple scheme: [parser] -> (untyped AST) -> [analyser] -> (typed AST) -> [LLVM] -> (object code). At first, as I want to use high-level interface, typed AST must satisfy all needed class constraints. For simple types and operations this can be solved by adding neccessary constraints to the corresponding definitions. But it's not very good solution, because in general typed AST can represent high-level data structures, that would have certain representation, known when generating code, but not checking logic. Problem becomes much more complex when I want to add function calls into my language. Type class CallArgs has an instance CallArgs (IO a) (CodeGenFunction r (Value a)), which can't be given as a constraint in typed AST because of free variable r. For a long time I have had no idea of how I can add function calls into my language. The only solution I see at the moment is to reject high-level llvm interface provided by llvm library and use directly FFI bindings to C. But I can't get rid of feeling that I'm missing something or doing all stuff totally wrong. It would be great if someone, who has experience in using high-level interface to LLVM for building a compiler, could help me. Thanks in advance, Nick

2 1

Impossible class instance?
by Emil Axelsson 16 May '11

16 May '11

Hello! At the end of this message is a program with a simple expression type, and a class `ToExpr` that generalizes expressions to arbitrary Haskell types. Every node in `Expr` is annotated with some abstract information. The program raises the following type error: test.hs:13:5: Couldn't match type `(,) a' with `(,) (a, a)' Inaccessible code in the instance declaration In the instance declaration for `ToExpr (a, b)' It seems that the mere existence of the constraint info (a,b) ~ (info a, info b) causes this error. I was hoping that this constraint would make it possible to construct the value (ia,ib) in the class instance, which is otherwise not allowed. Note: I don't want to make `info` an associated type. The idea is to make this work with any type function `info` that fulfills the above constraint. Is there any way to make this work? / Emil -------------------- {-# LANGUAGE UndecidableInstances #-} data Expr info a where Int :: info a -> Int -> Expr info a Pair :: info (a,b) -> Expr info a -> Expr info b -> Expr info (a,b) getInfo :: Expr info a -> info a getInfo (Int info _) = info getInfo (Pair info _ _) = info class ToExpr a where type Internal a toExpr :: a -> Expr info (Internal a) instance ( ToExpr a , ToExpr b , info (a,b) ~ (info a, info b) ) => ToExpr (a,b) where type Internal (a,b) = (Internal a, Internal b) toExpr (a,b) = Pair (ia,ib) (toExpr a) (toExpr b) where ia = getInfo a ib = getInfo b

1 1