- Haskell-Cafe - Haskell.org

Compliments on the "IO inside" tutorial
by Andriy Drozdyuk 05 Jan '13

05 Jan '13

I just wanted to express my gratitude to whoever wrote the "IO inside" tutorial: http://www.haskell.org/haskellwiki/IO_inside It is one of the best pieces of writing in Haskell I've ever come across: not only is it clear and very intuitive, but it also manages to strike a perfect balance between "programmers" and "beginner haskell programmers". It certainly ties together a lot of other stuff one reads in books and category theory - and actually makes sense! My sincere gratitude, and keep up great job. I can only hope to write something as clear and useful as this. My only complaint is that it is really wasting away inside the Haskell Wiki - which gives it a rather bad "reputation", since a lot of wiki pages are of much lower quality. This should be nicely formatted in a PDF file or a even part of a book! Make it pretty and get people to notice it!!! Now i must sleep, -Andriy Drozdyuk

2 1

Object Oriented programming for Functional Programmers
by Daniel Díaz Casanueva 05 Jan '13

05 Jan '13

Hello, Haskell Cafe folks. My programming life (which has started about 3-4 years ago) has always been in the functional paradigm. Eventually, I had to program in Pascal and Prolog for my University (where I learned Haskell). I also did some PHP, SQL and HTML while building some web sites, languages that I taught to myself. I have never had any contact with JavaScript though. But all these languages were in my life as secondary languages, being Haskell my predominant preference. Haskell was the first programming language I learned, and subsequent languages never seemed so natural and worthwhile to me. In fact, every time I had to use another language, I created a combinator library in Haskell to write it (this was the reason that brought me to start with the HaTeX library). Of course, this practice wasn't always the best approach. But, why I am writing this to you, haskellers? Well, my curiosity is bringing me to learn a new general purpose programming language. Haskellers are frequently comparing Object-Oriented languages with Haskell itself, but I have never programmed in any OO-language! (perhaps this is an uncommon case) I thought it could be good to me (as a programmer) to learn C/C++. Many interesting courses (most of them) use these languages and I feel like limited for being a Haskell programmer. It looks like I have to learn imperative programming (with side effects all over around) in some point of my programming life. So my questions for you all are: * Is it really worthwhile for me to learn OO-programming? * If so, where should I start? There are plenty of "functional programming for OO programmers" but I have never seen "OO programming for functional programmers". * Is it true that learning other programming languages leads to a better use of your favorite programming language? * Will I learn new programming strategies that I can use back in the Haskell world? Thanks in advance for your kind responses, Daniel Díaz.

22 47

Fwd: Foreign.Erlang help
by Junior White 04 Jan '13

04 Jan '13

Hi Alexandar, Thanks for your help! I give up Foreign.Erlang and try usual tcp server in Haskell instead. ---------- Forwarded message ---------- From: Junior White <efiish(a)gmail.com> Date: Fri, Jan 4, 2013 at 3:18 PM Subject: Re: [Haskell-cafe] Foreign.Erlang help To: Alexander Alexeev <mail(a)eax.me> Hi Alexandar, Thanks for your help! I'll give up Foreign.Erlang and try usual tcp server in Haskell instead. On Tue, Dec 25, 2012 at 4:08 PM, Alexander Alexeev <mail(a)eax.me> wrote: > First of all, you can write usual TCP server in Haskell and use it from > Erlang. It would be handy to use some widely used protocol, like Memcached > or Redis. > > If in some reason you want to use Foreign.Erlang, make sure that you are > using the same cookie and the same node name type (short or full) in Erlang > node and Haskell application. > > > On 12/24/2012 08:46 PM, Junior White wrote: > > Hi all, > I have a game server programming in erlang, but now i want to write some > game logic in haskell, how to write a haskell node for erlang? > > ps:I have read the introduce of Foreign.Erlang,I use haskell send a > message to a erlang echo server, but the server not receive anything. > > > _______________________________________________ > Haskell-Cafe mailing listHaskell-Cafe@haskell.orghttp://www.haskell.org/mailman/listinfo/haskell-cafe > > > > -- > Best regards, > Alexander Alexeevhttp://eax.me/ > >

1 0

Re: [Haskell-cafe] Mancunian Haskellers out there?
by James Jeffries 03 Jan '13

03 Jan '13

Hi there There isn't currently a haskell user groupu in Manchester, however there is a functional programming group where a lot of the member s are haskellers. http://www.lambdalounge.org.uk/ https://groups.google.com/forum/?fromgroups#!forum/lambda-lounge-manchester It is at Madlab in the Northern Quarter and there is usually a trip to the pub afterwards. Thanks James On 30/12/12 14:38, Alfredo Di Napoli wrote: Morning Cafe, I've been living in Manchester for 1 month now and I'm wondering if some on you are from the Greater Manchester area, so that we could chat about out beloved language in front of a glass of ale / tea :P Happy new year to everyone! A. _______________________________________________ Haskell-Cafe mailing list Haskell-Cafe(a)haskell.org <mailto:Haskell-Cafe@haskell.org <Haskell-Cafe(a)haskell.org>> http://www.haskell.org/mailman/listinfo/haskell-cafe

2 1

Re: [Haskell-cafe] [Haskell] Importing Repa library
by Henning Thielemann 03 Jan '13

03 Jan '13

On Thu, 3 Jan 2013, Емануела Моллова wrote: > Hello! :) I think you should better post your question to haskell-cafe(a)haskell.org. > Then I put this script > > import qualified Data.Array.Repa as R > :m +Data.Array.Repa > Z > > into the file "file.hs", This is GHCi syntax, but it is not a valid Haskell module as indicated by the .hs filename extension. > opened WinGHCi and loaded the file, and then evaluated it, but what I get is: > > Could not find module `Data.Array.Repa' > Perhaps you meant > Data.Array.Base (from array-0.4.0.0) > Data.Array.IO (from array-0.4.0.0) > Data.Array.ST (from array-0.4.0.0) > Use -v to see a list of the files searched for. > Failed, modules loaded: none. I wonder why it loads file.hs at all. I would expect that it gives a syntax error. > Also ghc-pkg list repa says: > > WARNING: cache is out of date: C:/Program Files/Haskell Platform/2012.4.0.0\lib\package.conf.d\package.cache > use 'ghc-pkg recache' to fix. C:/Program Files/Haskell Platform/2012.4.0.0\lib\package.conf.d: > C:\Users\Faery\AppData\Roaming\ghc\i386mingw32-7.4.2\package.conf.d: Since 'repa' is not listed, it was not installed successfully. This would be consistent with the "Could not find module" message of GHCi. You may post the output of the 'cabal install repa' run.

1 0

Proving programs
by Christopher Howard 03 Jan '13

03 Jan '13

I'm working through a video lecture describing how to prove programs correct, by first translating the program into a control flow representation and then using propositional logic. In the control flow section, the speaker described how the program should be understood in terms of an input vector (X, the inputs to the program), a program vector (Y, the storage variables), and an output vector (Z, the outputs of the program), with X mapping into Y, Y being affected by execution, and X and Y mapping into Z. However, only part way into the video, two practical questions come to mind: 1. Does this approach need to be adjusted for a functional language, in which computation is (at least idealistically) distinct from control flow? 2. How do we approach this for programs that have an input loop (or recursion)? E.g., I have an application that reads one line for stdin, modifies said line, outputs to stdout, and repeats this process until EOF? Should I be thinking of every iteration as a separate program? -- frigidcode.com

5 5

Safe 'chr' function?
by Myles C. Maxfield 03 Jan '13

03 Jan '13

Hello, I'm working on a general text-processing library [1] and one of my quickcheck tests is designed to make sure that my library doesn't throw exceptions (it returns an Either type on failure). However, there are some inputs that cause me to pass bogus values to the 'chr' function (such as 1208914), which causes it to throw an exception. Is there a version of that function that is safe? (I'm hoping for something like Int -> Maybe Char). Alternatively, is there a way to know ahead of time whether or not an Int will cause 'chr' to throw an exception? Thanks, Myles C. Maxfield [1] http://hackage.haskell.org/package/punycode

3 3

[Announcement] New SBV release
by Levent Erkok 03 Jan '13

03 Jan '13

I'm happy to announce v2.9 release of the Haskell SBV library: http://leventerkok.github.com/sbv/ SBV (SMT Based Verification) is a library that allows Haskell programs to take advantage of modern SMT solvers, by providing a symbolic simulation engine that can invoke 3rd party SMT solvers to prove/falsify properties about (a certain class of) Haskell programs. New in this release is the support for the CVC4 SMT solver: http://cvc4.cs.nyu.edu/web/ If you were planning to use SMT solvers before, but were worried about the not-so-commercial-friendly licenses of Yices and Z3, then this is a great opportunity: *CVC4 comes with essentially no limit on its use for research or commercial purposes*! Feedback, patches and bug reports are always welcome. -Levent.

1 0

Inference for RankNTypes
by Francesco Mazzoli 02 Jan '13

02 Jan '13

Hi list, I am a bit puzzled by the behaviour exemplified by this code: {-# LANGUAGE RankNTypes #-} one :: (forall a. a -> a) -> b -> b one f = f two = let f = flip one in f 'x' id three = (flip one :: b -> (forall a. a -> a) -> b) 'x' id four = flip one 'x' id Try to guess if this code typechecks, and if not what’s the error. While `two' and `three' are fine, GHC (7.4.1 and 7.6.1) complains about `four': Line 8: 1 error(s), 0 warning(s) Couldn't match expected type `forall a. a -> a' with actual type `a0 -> a0' In the third argument of `flip', namely `id' In the expression: flip one 'x' id In an equation for `four': four = flip one 'x' id So for some reason the quantified variable in `id' gets instantiated before it should, and I have no idea why. Any ideas? Francesco

3 8

Re: [Haskell-cafe] [Haskell-beginners] ghc and android
by Nathan Hüsken 02 Jan '13

02 Jan '13

After googling a little more, do I understand correctly that to compile haskell (with ghc) for Android, one would have to compile and run ghc itself on android (because it can not cross compile)? That seems almost impossible, I would need an android device with unusual capacity. I have heard that ghc for iphone is possible. Anyone knows how that is done? What is the difference for android? Regards, Nathan

6 6

Monaris
by Kazu Yamamoto 02 Jan '13

02 Jan '13

Happy new year from Japan. A young talented guy, @fumieval, has released Monaris, a Tetoris clone based on OpenGL. You can install it: % cabal install Monaris To my surprise, this game is implemented with free Monad. ;-) Regards, --Kazu

1 0

hsc2hs and Storable (especially) unsafe
by Evan Laforge 02 Jan '13

02 Jan '13

It so happens that on 64 bit OS X, haskell's Int is 64 bits, while C's int is 32 bits. hsc2hs's #poke does no typechecking at all, so if you have (#poke Struct, int_field) structp int -- where int :: Int Then you probably are going to corrupt memory, and in a particularly pernicious way (since chances are it won't segfault). Similarly, don't poke haskell Chars, it has to be CChar. And what's even worse, Foreign.withArrayLen gives you an Int, not a CInt! So doing the obvious thing and poking the pointer and length directly is wrong. And besides, shouldn't it be a CSize? Another trap: C++'s bool is probably one byte, haskell's Bool Storable says it's 4. It's probably not even correct to assume Double = CDouble and Float = CFloat, though it seems likely to be always true. I carefully vetted all my #pokes but I'm annoyed that hsc2hs and Foreign let me get away with this. If Storable is for marshalling types to and from C, then non-C types should not be Storable! If Storable is useful for other things (and it is!), then Foreign should define its own CStorable, that only includes C types, and hsc2hs should use that! While we're at it, fromIntegral is not a safe way to convert a haskell type to a C one. But it sure is a tempting one, because Foreign.C doesn't provide any conversion functions (except for Bool). We should have explicit conversion functions that give the choice of crashing with an error or clamping the number to the (smaller) C type's bounds. I'm not sure if anyone wants what fromIntegral does. Or maybe I shouldn't be using hsc2hs in the first place. I feel more and more that it gives haskell a bad name, being low level and error prone. I used bindings-dsl for a libgit2 binding, and at least it automates Storable instances, so it's less error-prone that way. I'd like to generate instances directly from .h files though, so I should probably check out c2hs. Back in the day when I was deciding to use hsc2hs I noticed how it lacks typechecking, but I thought that it's just a few fields, I can be careful when writing them. But one of the lessons from haskell (and static analysis in general) is that "just be careful" is going to fail you some day, probably sooner than you think. So anyway, I wrote a ForeignC module that defines CStorable that only includes C types. At first I thought I could make Storable a superclass and just re-export functions with more restritive signatures, but then it gets tricky because you wind up needing the Storable peek and poke to declare Storable instances. So I defined a completely new CStorable, and all you need to do is import ForeignC instead of Foreign, and change 'instance Storable ...' to 'instance CStorable ...'. Unfortunately that apparently means copy-pasting over the Storable-using utilities like 'with' and 'newArray'. On the plus side, I dropped it into my .hsc modules, and it found several *more* mistakes. I was thinking of putting it on hackage (along with the conversion functions), since other people might have made these same mistakes, but it's unpleasant because it duplicates so much from Foreign. Also, I only copied over the bits I'm using, so it's not complete either. Is there a better way to create safe Storable instances for C? I'd be happier with a solution that avoids the need to write Storable instances in the first place, but hsc2hs is here now, and used in a lot of places.

1 0

Haskell Summers of Code retrospective (updated for 2012)
by Gwern Branwen 02 Jan '13

02 Jan '13

The Wheel turns, and months come and pass, leaving web links that fade into 403 Forbiddens; a wind rose in NYC, whispering of the coming Winter... As is now customary for me, I've looked into how the 2012 SoCs went - the better to feed my misanthropic heart by mocking the students who failed my whimsically arbitrary and subjective standards: http://www.gwern.net/Haskell%20Summer%20of%20Code#results-2 This was not a good year. 2 students simply dropped out period, and 3 other projects turned out badly, leaving just 2 clearly successful projects for the year. Hopefully 2013 will turn out better. /r/haskell: http://www.reddit.com/r/haskell/comments/15sjur/summer_of_code_2012_retrosp… -- gwern

1 0

ANNOUNCE: graphviz-2999.15.0.0
by Ivan Lazar Miljenovic 01 Jan '13

01 Jan '13

After much prodding and poking by end-users for the past few months, I'm finally able to announce a GHC-7.6.1 compatible release of my Haskell bindings to the Graphviz graph visualisation toolkit: http://hackage.haskell.org/package/graphviz-2999.15.0.0 (It took me so long to release a version that allowed bytestring-0.10.* as I was waiting for upstream to get back to me about an inconsistency I found; in the end I decided to just try and cope with how it seems to work.) The list of changes since the last release are: * The repository is now hosted at http://hub.darcs.net/ivanm/graphviz, and using the bug-tracker there. * Updates to various `Attribute` definitions: - The list of available shapes has been expanded to take into account the new synthetic biology shapes. - The `Size` and `FontNames` attributes now have specified data types. - The optional start and end points for `Spline`s were previously the wrong way round; this has now been fixed. - Explicitly only print 2-dimensional `Point` values for `Rect` and `DPoint` (previously only 2-dimensional values where parsed, but it was possible to print a 3-dimensional value). - HTML-like labels previously disallowed empty textual label components when parsing; spotted by Daniel Hummel. * `GraphvizParams` now lets you specify whether a "cluster" is actually a cluster or a sub-graph. Requested by Gabor Greif. * Fixed an error where printing edges whose attributes contained a `ColorScheme` attribute, that attribute would stay in the state and the old color scheme would override the _parent's_ state. * Previously, some malformed attributes were accepted when being parsed as they silently became parsed as an `UnknownAttribute`. Now, attributes where the attribute name and the equal sign are successfully parsed **but** the value of the attribute is _not_ successfully parse will throw an unrecoverable error. **Note**: this does mean that some Dot graphs that are accepted by Graphviz (as they separate tokenizing from parsing; as such something like `"0.1"` is successfully accepted as an integer, specifically `0`) are no longer accepted when parsing them in. * Miscellaneous parsing improvements: - Whilst not specified anywhere, Graphviz seems to treat empty quotes as values for attributes expecting a number as their default; as such, this is now taken into account when parsing. - `DPoint` values can now parse an optional `+` prefix. - Whitespaces after commas in HSV colors are now accepted. * Error messages from parsing are improved to help you track down where the parsing error occurred (in that it's easier to find which attribute failed to parse, etc.). -- Ivan Lazar Miljenovic Ivan.Miljenovic(a)gmail.com http://IvanMiljenovic.wordpress.com

2 2

A big hurray for lambda-case (and all the other good stuff)
by Ben Franksen 01 Jan '13

01 Jan '13

Hi Everyone just wanted to drop by to say how much I like the new lambda case extension. I use it all the time and I just *love* how it relieves me from conjuring up dummy variables, which makes teh code not only esier to write but also to read. A big, huge thank you to the ghc developers. This has been sooooo long on my wish list. Also much appreciated and long awaited: tuple sections (though I use them not quite as often). Both should *definitely* go into Haskell'13. Of course, thank you also for all the other beautiful stuff in ghc-7.6.1, especially PolyKinds, DataKinds etc. GHC is just simply amazing. You guys RULE THE WORLD! Cheers -- Ben Franksen () ascii ribbon campaign - against html e-mail /\ www.asciiribbon.org - against proprietary attachments

15 18

Mancunian Haskellers out there?
by Alfredo Di Napoli 01 Jan '13

01 Jan '13

Morning Cafe, I've been living in Manchester for 1 month now and I'm wondering if some on you are from the Greater Manchester area, so that we could chat about out beloved language in front of a glass of ale / tea :P Happy new year to everyone! A.

5 6

Backtracking in HXT
by Mateusz Kowalczyk 01 Jan '13

01 Jan '13

Hello, I'm not sure if this is the right place to ask this but here goes. I'm currently working with HXT and I quite like it. There's one issue I can't solve (at least now without some dirty, dirty hacking) and I'm sure it's fairly simple. Consider the following mark-up <a href="example.com/somelink.html">Hello One!</a> <a href="example.com/anotherlink.html">Hello Two!</a> Now, what I'm trying to achieve is to get the href based on the text. I can test for what the text is by traversing <a>s, then using the getChildren >>> getText arrow. What I can't figure out is how to check the text and then get the href as by the time I get to the text, I'll further down the tree! I imagine it would look something along the lines of (getChildren >>> getText <?*> "Hello Two") `guards` getAttrValue "href". <?*> is just a random operator I made up for illustration purposes that works as a predicate over arrows. Is this the right approach? Is there a built-in that already does what I want? It seems like a common task... Mateusz Kowalczyk

2 3

Handling Joystick with GLFW
by Thiago Negri 01 Jan '13

01 Jan '13

I'm trying to handle my usb controller (xbox model) via GLFW. I can get it's input, but I see a strange behaviour in my sample application that I couldn't explain. Can you enlight me please? If I disable automatic event polling on buffer swapping (line "A"), the screen content is refreshed but OS part is unresposive: I can't resize, move, etc. With automatic event polling enabled, everything is fine. I tried disabling automatic event polling and calling "waitEvents" (line "B") before refreshing the screen. But, changes to the joystick input do not generate any event, so I need to move the mouse or type a key to release "waitEvents" call. What am I missing? I'm using Windows 7 64-bit. The code is available here: http://hpaste.org/80031

1 0

Fwd: Object Oriented programming for Functional Programmers
by Eli Frey 31 Dec '12

31 Dec '12

sorry, forgot to reply-all ---------- Forwarded message ---------- From: Eli Frey <eli.lee.frey(a)gmail.com> Date: Sun, Dec 30, 2012 at 1:56 PM Subject: Re: [Haskell-cafe] Object Oriented programming for Functional Programmers To: Brandon Allbery <allbery.b(a)gmail.com> > Except not quite... [...] It's not a built in table, it's a hidden parameter. I'll admit this doesn't HAVE to be the implementation. Often time the compiler can monomorphise the types and "perform the lookup" at compile time. But what's going on here tho. > {-# LANGUAGE ExistentialQuantification #-} > data Showable = forall a. Show a => Showable a > > printShowable :: Showable -> IO () > printShowable (Showable x) = print x > > main = mapM printShowable [ Showable "bob", Showable 3, Showable Nothing ] If we take `mapM printShowable` and just give it an arbitrary list, it has to lookup the correct implementations of `print` as it walks down that list at run-time. I believe similar things motivate vtables in c++/java. I don't have a strong intuition about how dynamically typed OO langs deal with this, but I'm sure structural typing has similar issues. On Sun, Dec 30, 2012 at 1:27 PM, Brandon Allbery <allbery.b(a)gmail.com>wrote: > On Sun, Dec 30, 2012 at 3:45 PM, Eli Frey <eli.lee.frey(a)gmail.com> wrote: > >> > mconcat :: Monad m => [m] -> m >> > mconcat = foldl mappend [] >> >> We can think of `mconcat` having a little lookup table inside of itself, >> and whenever we pass it a concrete `[m]`, `mappend` gets looked up and we >> get the implementation for `m`. Typeclasses are just mappings from types >> to functions >> > > Except not quite... the "Monad m =>" in the signature really means "hey, > compiler, pass me the appropriate implementation of Monad so I can figure > out what I'm doing with this type m". It's not a built in table, it's a > hidden parameter. > > Aside from Object Orientation, it is probably a good idea to learn some C >> for a bit too. C is a good language to play in and try and implement more >> advanced language features. Once you reallize that objects are just lookup >> tables of functions bound with a data-structure, you can implement your own >> in C, or you can make closures as functions bundled with (some) of their >> arguments, or you can implement interesting datastructures, or so many >> other fun things. A good understanding of tagged unions has helped me in >> many a convo with an OO head. >> > > A perhaps strange suggestion in this vein: dig up the source code for Xt, > the old X11 Toolkit, and the Xaw widget library that is built atop it. > (It's part of the X11 source tree, since most of the basic X11 utilities > and xterm are based on it.) It implements a primitive object system in C. > Gtk+ does the same, but hides much of the implementation behind macros and > relies on tricky casting etc. behind the scenes for performance; in Xt, the > basic machinery is more easily visible for inspection and much easier to > understand even if you're not all that familiar with C. If you go this > way, once you've figured out what Xt is doing you might go on to see the > more advanced concepts in how Gtk+ does it. > > And once you've done this, you'll have a good idea of what Objective-C and > C++ (minus templates) are doing under the covers. (Mostly C++, since ObjC > is more or less Smalltalk's OO on top of X, whereas the core concepts of > C++ are not so very different from what Xt does.) If you really want to > dig in further, you might want to try to find the source to cfront, the > original C++ implementation which was a preprocessor for the C compiler. > It'll be missing a lot of modern C++ features, but the core is there. > > -- > brandon s allbery kf8nh sine nomine > associates > allbery.b(a)gmail.com > ballbery(a)sinenomine.net > unix, openafs, kerberos, infrastructure, xmonad > http://sinenomine.net >

2 1

ANNOUNCE: bindings to workqueue for distributed applications
by Badi' Abdul-Wahid 31 Dec '12

31 Dec '12

Hello all I'm announcing a release of bindings to the WorkQueue distributed computing framework. This release comprises two packages: - bindings-cctools: low-level FFI bindings http://hackage.haskell.org/package/bindings-cctools - cctools-workqueue: high-level interface built on top of bindings-cctools http://hackage.haskell.org/package/cctools-workqueue WorkQueue is a Master/Worker framework for building flexible, fault-tolerant, distributed applications. WorkQueue has been used to scale to several thousand nodes, combining resources from different execution environments (HPC, cycle-scavenging, Cloud). Details can be found on the project website: http://www.nd.edu/~ccl/software/workqueue The current bindings are for version 3.6.1 of CCTools. Here are documentation for bindings-cctools and cctools-workqueue: http://nd.edu/~cabdulwa/haskell/doc/bindings-cctools-3.6.1.0.1.0.0/html http://nd.edu/~cabdulwa/haskell/doc/cctools-workqueue-3.6.1.0.1.0.0/html A documented example can be found in the repository. http://bitbucket.org/badi/hs-cctools-workqueue/src/v3.6.1.0.1.0.0/Example.hs If you want to try out these bindings, you will need to install CCTools first. http://www.nd.edu/~ccl/software/download.shtml Any feedback is welcome. Thanks. -- Badi' Abdul-Wahid

1 0

Gloss and relatively expensive computations
by Daniel Díaz Casanueva 30 Dec '12

30 Dec '12

Hello cafe! I'm having some performance issues trying to use gloss to make animations where each "model" step is relatively time expensive. I'm using the IO.Simulate module because my step function needs to do an IO operation which takes around 1 second (it may vary). I will try to give some details. I have the step function: step :: Model -> IO Model step m = do ... p <- slowOperation ... return newModel The rest of the program is small and simple. The drawing function (Model -> IO Picture -- it is pure though) is as quick as simple. However, the program get stuck after the first iteration. In the other hand, I am using the animateIO function which ask me for an Int value to set up "the number of simulation steps to take for each second of real time". But I'm more interested in the animation waiting for the simulation step to end. Does it make sense? I would be really thankful with any pointer here. Thanks in advance, Daniel Díaz.

2 2

Re: [Haskell-cafe] [Haskell-beginners] ghc and android
by Nathan Hüsken 30 Dec '12

30 Dec '12

On 12/30/2012 03:43 PM, Brandon Allbery wrote: > On Sun, Dec 30, 2012 at 8:19 AM, Nathan Hüsken <nathan.huesken(a)posteo.de>wrote: > >> Is it currently possible to build haskell programs for android using the >> android NDK? >> If course, I know, bindings have to be written and android GUIs have to be >> written in Java. But if I would write the bindings for the things I need...? >> > > GUIs can be written without requiring Java/Dalvik, at least on the more > recent versions of Android. It's the basic runtime support that is still a > bit lacking, last I checked. Oh, cool. I did not know that. > > >> Via C/gcc? Its not the fastest, but should work, should it not? >> > > It's nonexistent for ARM; to get a working -fvia-C you have to go back to > ghc versions that don't have any clue about ARM (if you want to scare > yourself, check out via-C's Evil Mangler sometime). And I think the hosted > build isn't working at the moment? > > >> Via llvm? >> > > I believe this is how current ARM development is doing it, rather than try > to code up a native code generation backend. (I also get the impression > that the NCGs are going to be deprecated in favor of -fllvm at some point, > although they want to clean up some lingering optimization issues first; > llvm wins for many things but does somewhat poorly for a few.) > > An additional issue: ghci (and Template Haskell because it uses the > bytecode interpreter of ghci internally) currently(?) requires its own > custom linker instead of being able to use the system linker. Said linker > has no support for ARM. The correct fix for this is to redesign ghci so it > doesn't need its own linker; there has been some work in this direction, > but I don't know how complete it is, and it interacts with other issues > such as building Haskell libraries as shared objects. > With ghci, the consol haskell shell is meant, correct? I do not think I would need ghci on android, for what? I think I can live without template haskell.

2 1

ghc and android
by Nathan Hüsken 30 Dec '12

30 Dec '12

As suggested on the haskell beginners list, I am taking this to haskell-cafe. Hey, I know, this question has been asked in the past and there is a lot information one can find in the net. But in all of this information, I can not find definite answers for this. Is it currently possible to build haskell programs for android using the android NDK? If course, I know, bindings have to be written and android GUIs have to be written in Java. But if I would write the bindings for the things I need...? Via C/gcc? Its not the fastest, but should work, should it not? Via llvm? If not, what is the problem in doing this? Thank you! Nathan _______________________________________________ Beginners mailing list Beginners(a)haskell.org http://www.haskell.org/mailman/listinfo/beginners

1 0

Retiring as maintainer of dataenc
by Magnus Therning 29 Dec '12

29 Dec '12

Hi all, A few years ago I found a need to base64 encode a bit of text inside vim and realised that there was no convenient way of doing it. This resulted in dataenc[1] and a pair of tools built on it, omnicodec[2]. The main goals were to make dataenc correct, support many encodings, and easy to maintain. This resulted in very simple (some would say naïve) code, with fairly good test coverage. As some have noticed, this simplicity in algorithm results in rather bad performance on large data. Which is why I've been planning for a replacement for a while now. This replacement is now here, sandi[3]. The goals of sandi are similar to dataenc, correct, many encodings, fairly simple, but also reasonably fast. This means that I personally think dataenc has reached the end of its life and I won't spend any more time on maintaining it. If anyone is interested in taking over maintenance then please announce it on the list. /M [1]: http://hackage.haskell.org/package/dataenc [2]: http://hackage.haskell.org/package/omnicodec [3]: http://hackage.haskell.org/package/sandi -- Magnus Therning OpenPGP: 0xAB4DFBA4 email: magnus(a)therning.org jabber: magnus(a)therning.org twitter: magthe http://therning.org/magnus I invented the term Object-Oriented, and I can tell you I did not have C++ in mind. -- Alan Kay

1 0

ANN: sandi 0.1.1 - a data encoding/decoding library
by Magnus Therning 29 Dec '12

29 Dec '12

The other day I released version 0.1.1 of sandi, a data encoding/decoding library supporting the following encodings: base16, base32, base32hex, base64, base64url, base85, quoted-printable, uuencode, xxencode, yEnc I believe it's reasonably fast, but I still have to look more closely at criterion to get some hard numbers confirming that :) More details can be found at http://hackage.haskell.org/package/sandi /M -- Magnus Therning OpenPGP: 0xAB4DFBA4 email: magnus(a)therning.org jabber: magnus(a)therning.org twitter: magthe http://therning.org/magnus Perl is another example of filling a tiny, short-term need, and then being a real problem in the longer term. -- Alan Kay

1 0

getting upload date from hackage-db?
by Patrick Pelletier 29 Dec '12

29 Dec '12

(Firstly, I apologize if this is not the right mailing list for this question. But haskell-cafe seems to be the place to go when in doubt.) I'm using the hackage-db package (Distribution.Hackage.DB) to analyze Hackage programatically. It parses 00-index.tar and provides a mapping from package name and version to a GenericPackageDescription. I've figured out how to get most of the information I want from the GenericPackageDescription. But one piece of information that's present on the Hackage web pages that I'd like to be able to get is "Upload date", but I can't find this information anywhere in the GenericPackageDescription. Am I missing it? It looks like the modification dates of the cabal files inside 00- index.tar correspond to the upload date. Is this correct? If so, I could parse this out of 00-index.tar myself (using the "tar" package). Is that the best way to do what I'm trying to accomplish, or is there a better, less "reinventing the wheel" way that I'm missing? Thanks, --Patrick

1 0

ANN: shelltestrunner 1.3
by Simon Michael 28 Dec '12

28 Dec '12

I'm pleased to announce the release of shelltestrunner 1.3. New in this release: * support latest Diff, cmdargs, test-framework; tested with GHC 7.6.1 (Magnus Therning) * fix unicode handling on GHC >= 7.2 shelltestrunner tests command-line programs (or arbitrary shell commands.) It reads simple declarative tests specifying a command, some input, and the expected output, and can run them run in parallel, selectively, with a timeout, in color, and/or with differences highlighted. shelltestrunner has been tested on gnu/linux, mac and windows; projects using it include hledger, berp, cblrepo and eddie. shelltestrunner is free software released under GPLv3+. Home: http://joyful.com/shelltestrunner Install: $ cabal install shelltestrunner

1 0

my Fasta is slow ;(
by Branimir Maksimovic 28 Dec '12

28 Dec '12

This time I have tried fasta benchmark since current entries does notdisplay correct output.Program is copy of mine http://benchmarksgame.alioth.debian.org/u64q/program.php?test=fasta&lang=gp… benchmark, but unfortunately executes more than twice time. Seems to me that culprit is in function random as I have tested rest of codeand didn't found speed related problems. bmaxa@maxa:~/shootout/fasta$ time ./fastahs 25000000 > /dev/null real 0m5.262suser 0m5.228ssys 0m0.020s bmaxa@maxa:~/shootout/fasta$ time ./fastacpp 25000000 > /dev/null real 0m2.075suser 0m2.056ssys 0m0.012s Since I am planning to contribute program, perhaps someone cansee a problem to speed it up at least around 3.5 secs which is speed of bench that display incorrect result (in 7.6.1). Program follows: {-# LANGUAGE BangPatterns #-}{- The Computer Language Benchmarks Game http://shootout.alioth.debian.org/ contributed by Branimir Maksimovic-} import System.Environmentimport System.IO.Unsafe import Data.IORefimport Data.Array.Unboxedimport Data.Array.Storableimport Data.Array.Baseimport Data.Word import Foreign.Ptrimport Foreign.C.Types type A = UArray Int Word8type B = StorableArray Int Word8type C = (UArray Int Word8,UArray Int Double) foreign import ccall unsafe "stdio.h" puts :: Ptr a -> IO ()foreign import ccall unsafe "string.h" strlen :: Ptr a -> IO CInt main :: IO () main = do n <- getArgs >>= readIO.head let !a = (listArray (0,(length alu)-1) $ map (fromIntegral. fromEnum) alu:: A) make "ONE" "Homo sapiens alu" (n*2) $ Main.repeat a (length alu) make "TWO" "IUB ambiguity codes" (n*3) $ random iub make "THREE" "Homo sapiens frequency" (n*5) $ random homosapiens make :: String -> String -> Int -> IO Word8 -> IO (){-# INLINE make #-}make id desc n f = do let lst = ">" ++ id ++ " " ++ desc a <- (newListArray (0,length lst) $ map (fromIntegral. fromEnum) lst:: IO B) unsafeWrite a (length lst) 0 pr a make' n 0 where make' :: Int -> Int -> IO () make' !n !i = do let line = (unsafePerformIO $ newArray (0,60) 0 :: B) if n > 0 then do !c <- f unsafeWrite line i c if i+1 >= 60 then do pr line make' (n-1) 0 else make' (n-1) (i+1) else do unsafeWrite line i 0 l <- len line if l /= 0 then pr line else return () pr :: B -> IO ()pr line = withStorableArray line (\ptr -> puts ptr)len :: B -> IO CIntlen line = withStorableArray line (\ptr -> strlen ptr) repeat :: A -> Int -> IO Word8repeat xs !n = do let v = unsafePerformIO $ newIORef 0 !i <- readIORef v if i+1 >= n then writeIORef v 0 else writeIORef v (i+1) return $ xs `unsafeAt` i random :: C -> IO Word8random (a,b) = do !rnd <- rand let find :: Int -> IO Word8 find !i = let !c = a `unsafeAt` i !p = b `unsafeAt` i in if p >= rnd then return c else find (i+1) find 0 rand :: IO Double{-# INLINE rand #-}rand = do !seed <- readIORef last let newseed = (seed * ia + ic) `rem` im newran = fromIntegral newseed * rimd rimd = 1.0 / (fromIntegral im) im, ia, ic :: Int im = 139968 ia = 3877 ic = 29573 writeIORef last newseed return newran where last = unsafePerformIO $ newIORef 42 alu :: [Char] alu = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ \GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ \CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ \ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ \GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ \AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ \AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" mkCum :: [(Char,Double)] -> [(Word8,Double)]mkCum lst = map (\(c,p) -> ((fromIntegral.fromEnum) c,p)) $ scanl1 (\(_,p) (c',p') -> (c', p+p')) lst homosapiens, iub :: C iub' = mkCum [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02) ,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02) ,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)] homosapiens' = mkCum [('a',0.3029549426680),('c',0.1979883004921) ,('g',0.1975473066391),('t',0.3015094502008)] iub = (listArray (0, (length iub')-1) $ map fst iub', listArray (0, (length iub')-1) $ map snd iub') homosapiens = (listArray (0, (length homosapiens')-1) $ map fst homosapiens', listArray (0, (length homosapiens')-1) $ map snd homosapiens')

2 4

Documentation operator
by Christopher Done 28 Dec '12

28 Dec '12

Hello chums, I've been playing around with an idea, something that has obvious pros and cons, but I'll sell it to you because there might be some positive ideas out of it. Consider the following operator: {-# LANGUAGE TypeOperators, DataKinds, KindSignatures #-} module Docs where import GHC.TypeLits type a ? (sym :: Symbol) = a First I'll describe how I'd want to use this and then what I think are the advantages and disadvantages. I call this (?) operator “the documentation operator”, to be used for: * Things that either don't belong or can't be encoded in the type system, or for things need to be in English. * Things that cannot be encoded in Haddock. The simple case of ye olde days: -- | Lorem ipsum dolor sit amet. Suspendisse lacinia nibh et -- leo. Aenean auctor aliquam dapibus. loremIpsum :: Int -> Int -> String Which has since been somewhat evolved into: loremIpsum :: Int -- ^ Lorem ipsum dolor sit amet. -> Int -- ^ Suspendisse lacinia nibh et leo. -> String -- ^ Aenean auctor aliquam dapibus. But could now be written: loremIpsum :: Int ? "Lorem ipsum dolor sit amet." -> Int ? "Suspendisse lacinia nibh et leo." -> String ? "Aenean auctor aliquam dapibus." Here is a contrived case I'll use later on: data Person = Person describeAge :: Int ? "an age" -> String ? "description of their elderliness" describeAge n = undefined personAge :: Person ? "a person" -> Int ? "their age" personAge = undefined One could also encode previously informal specifications more formally, so that -- | The action 'hFlush' @hdl@ causes any items buffered for output -- in handle @hdl@ to be sent immediately to the operating system. -- -- This operation may fail with: -- -- * 'isFullError' if the device is full; -- -- * 'isPermissionError' if a system resource limit would be exceeded. -- It is unspecified whether the characters in the buffer are discarded -- or retained under these circumstances. hFlush :: Handle -> IO () hFlush handle = wantWritableHandle "hFlush" handle flushWriteBuffer with type Throws ex (docs :: Symbol) = docs could now be written hFlush :: Handle ? "flush buffered items for output on this handle" -> IO () ? Throws IsFullError "if the device is full" ? Throws IsPermissionError "if a system resource limit would be exceeded. It is \ \unspecified whether the characters in the buffer are \ \discarded or retained under these circumstances." hFlush handle = wantWritableHandle "hFlush" handle flushWriteBuffer With this in place, in GHCi you get documentation "lookup" for free: > :t hFlush hFlush :: (Handle ? "flush buffered items for output on this handle") -> (IO () ? Throws IsFullError "if the device is full") ? Throws IsPermissionError "if a system resource limit would be exceeded. It is unspecified whether the characters in the buffer are discarded or retained under these circumstances." And you get function composition, or “documentation composition” for free: > :t describeAge . personAge describeAge . personAge :: (Person ? "a person") -> String ? "description of their elderliness" We could have a :td command to print it with docs, and otherwise docs could be stripped out trivially by removing the ? annotations: > :t describeAge . personAge describeAge . personAge :: Person -> String > :td describeAge . personAge describeAge . personAge :: (Person ? "a person") -> String ? "description of their elderliness" You could even add clever printing of such “documentation types”: > :t hFlush hFlush :: Handle — flush buffered items for output on this handle -> IO () Throws IsFullError if the device is full" Throws IsPermissionError if a system resource limit would be exceeded. It is unspecified whether the characters in the buffer are discarded or retained under these circumstances." Unfortunately it doesn't work with monadic composition, of course. So here are the advantages: * You get parsing for free (and anyone using haskell-src-exts). * You get checking for free (i.e. GHC can check that IsFullError exists for you). * You get a continuity of documentation through your operations including composition. * You can extend the "documentation language" easily by just defining some types (like the Throws I used above). SeeMore, Author, Deprecated, etc. Whatever. * You can print out some helpful looking documentation in GHCi based on these simple types. * There's no longer this informal "it might throw this exception" kind of pros we're forced to write. * It could also be used for annotations other than pure documentation, including testing. E.g. add a Testable "property" and then your test framework can search for functions with this Testable annotation. * Free of Haddock's syntax. Here are the disadvantages: * It doesn't work for types. * Writing big pros inside a string can be boring without a decent editor. * The neat composition trick only goes so far. * There might be a compilation overhead. * It would require an updated GHCi to strip them out when not wanted. * Requires GHC 7.6.1+. Conclusions: What we have now for documentation is pretty good, especially generated documentation. Compared to other languages Haskell is quite well documented, I feel. But we can do more with it. In some languages, documentation is built into the language. You can ask for documentation inside the REPL, it belongs to that piece of code. It shouldn't, I don't think, be left as a code comment which is essentially whitespace as far as the compiler is concerned. Two sweet ideas that I like from the above are: * The checking by GHC. * The extension of the "documentation language", with the ability to formalize things like what exceptions are thrown. * Composing functions generates "new" documentation that still makes sense. Thoughts? Ciao!

4 3

Non polymorphic numerals option -- avoiding type classes
by Rustom Mody 27 Dec '12

27 Dec '12

In haskell, we have Prelude> :t 4 4 :: Num a => a Prelude> This may be nice in its generality but it makes it hard (for me at least) when teaching a beginners course to teach polymorphic vs monomorphic types. The above leads to even more 'advanced' results like this: Prelude> :t [[1],2] [[1],2] :: (Num [t], Num t) => [[t]] Prelude> [[1],2] <interactive>:5:6: No instance for (Num [t0]) arising from the literal `2' Possible fix: add an instance declaration for (Num [t0]) In the expression: 2 In the expression: [[1], 2] In an equation for `it': it = [[1], 2] By contrast in gofer, numeric literals are monomorphic and no such peculiarities arise ? :t [[1],2] ERROR: Type error in list *** expression : [[1],2] *** term : 2 *** type : Int *** does not match : [Int] [[1],2] ERROR: Type error in list *** expression : [[1],2] *** term : 2 *** type : Int *** does not match : [Int] So is there any set of flags to make haskell literals less polymorphic? ie I want 3 to have type Int and 3.0 to have type Float. This is of course for beginning students to not see type classes too early

6 11

Decent docs to my visualization tools
by Eugene Kirpichov 27 Dec '12

27 Dec '12

Hi cafe, I just finally published a decent documentation website and binary distributions for my log visualization tools written in Haskell - http://jkff.info/software/timeplotters/ . I think now they might actually stand a chance of starting to be adopted by a wider circle than my friends :) Feedback and sharing would be very welcome. -- Eugene Kirpichov http://www.linkedin.com/in/eugenekirpichov

1 0

ANNOUNCE: haskell-docs - Given a module name and a name, it will find and display the documentation of that name.
by Christopher Done 27 Dec '12

27 Dec '12

Ahoy hoy, Just thought I'd announce a tool I whipped up these evening to take a module name and a name and output the installed Haddock documentation for it. Examples with my GHCi session: λ> :doc Data.List.Split split Split a list according to the given splitting strategy. This is how to "run" a Splitter that has been built using the other combinators. λ> :doc Control.Concurrent.MVar swapMVar Take a value from an MVar, put a new value into the MVar and return the value taken. This function is atomic only if there are no other producers for this MVar. λ> :doc Data.List sort Ambiguous module, belongs to more than one package: base haskell2010-1.1.0.1 Continuing anyway... Package: base The sort function implements a stable sorting algorithm. It is a special case of sortBy, which allows the programmer to supply their own comparison function. Please have a play with it, the package is at: http://hackage.haskell.org/package/haskell-docs It has installation instructions. Feel free to share any issues that you have, either here, or on the Github page: https://github.com/chrisdone/haskell-docs There are some issues to do with versioning that I'm not sure how to solve in a standard way. The obvious next step is to have a -package-conf flag so that it can be used with cabal-dev. The wizards on #haskell are currently thinking of a way to avoid having to write the module name and just use what's in scope. Ciao!

4 3

Virthualenv/HsEnv in Windows
by Kyle Hanson 27 Dec '12

27 Dec '12

Has anyone gotten this to work on Windows either native or on cygwin? Is there an alternative? Happy Holidays, Kyle Hanson

2 1

Type error when trying to adapt http-proxy to new conduit
by Pieter Laeremans 27 Dec '12

27 Dec '12

Hi, The http-proxy package isn't compatible any longer with the latest conduit. Since it is open source, I thought, I might as well try to adapt it and submit a patch. However I run into some difficulties. For example I get this type error when I'm trying to compile it : Network/HTTP/Proxy.hs:254:15: Couldn't match expected type `ResourceT IO (CIN.Pipe () () ByteString () (ResourceT IO) ())' with actual type `IO (CIN.Pipe () () ByteString () (ResourceT IO) ())' I can't figure it out. To me it reads like : Expected x, actual x. Anyone has a clue? thanks, Pieter -- Pieter Laeremans <pieter(a)laeremans.org> "The future is here. It's just not evenly distributed yet." W. Gibson

4 3

ANNOUNCE: Haskell BOF on 29c3 in Hamburg, Germany
by Matthias Fischmann 27 Dec '12

27 Dec '12

Hi everybody, we will be running a nano-hackathon on the CCC congress in Hamburg on Thursday, 2012-12-27, 5pm German time: https://events.ccc.de/congress/2012/wiki/Haskell_BOF Sorry for the short notice. If you would like to meet up later during the congress please drop us a line. cheers, matthias

2 1

Substituting values
by Radical 26 Dec '12

26 Dec '12

Sometimes I'll need something like: if value == Foo then Bar else value Or some syntactic variation thereof: case value of { Foo -> Bar; _ -> value } Is there a better/shorter way to do it? I'm surprised that it's more complicated to substitute a value on its own than e.g. in a list, using filter. Or perhaps I'm missing the right abstraction? Thanks, Alvaro

6 8

How to fold on types?
by Magicloud Magiclouds 26 Dec '12

26 Dec '12

Say I have things like: data LongDec = LongDef a b c ... x y z values = [ 'a', 'b', 'c', ... 'x', 'y', 'z' ] Now I want them to be "LongDef 'a' 'b' 'c' ... 'x' 'y' 'z'". In form, this is something like folding. But since the type changes, so code like following won't work: foldl (\def value -> def value) LongDef values Is it possible to do this in some way? -- 竹密岂妨流水过山高哪阻野云飞 And for G+, please use magiclouds#gmail.com.

4 6

multi-thread and lazy evaluation
by Corentin Dupont 25 Dec '12

25 Dec '12

Hi all, I have a program where the user can submit his own little programs, which are interpreted using Hint. The user-submitted programs are used to modify a state held in a TVar. As of course those user-submitted programs can't be trusted, I'm trying to protect them, like in Mueval. I installed a watchdog to monitor and kill the user's thread if it doesn't finish. However it doesn't work properly, due to lazy evaluation I believe. I made a little exemple to illustrate the problem. -> The following program doesn't terminate, but if you uncomment the "putStrLn" at the end, it will. Could someone explain me this and how to do it properly?? Merry Christmas to all!!!! Corentin * {-# LANGUAGE ScopedTypeVariables #-} import Control.Concurrent.STM.TVar import Control.Concurrent.MVar import Control.Concurrent import Control.Monad.STM data MyData = MyData { a :: String, b :: String } deriving (Show) main = do tv <- atomically $ newTVar $ MyData "a" "b" protectedExecCommand tv myNewData <- atomically $ readTVar tv putStrLn $ show myNewData protectedExecCommand :: (TVar MyData) -> IO () protectedExecCommand tv = do mv <- newEmptyMVar before <- atomically $ readTVar tv id <- forkIO $ execBlocking mv forkIO $ watchDog' 5 id mv res <- takeMVar mv case res of Nothing -> (atomically $ writeTVar tv before) Just after -> (atomically $ writeTVar tv after) watchDog' :: Int -> ThreadId -> MVar (Maybe x) -> IO () watchDog' t tid mv = do threadDelay $ t * 1000000 killThread tid putStrLn $ "process timeout " tryPutMVar mv Nothing return () execBlocking :: MVar (Maybe MyData) -> IO () execBlocking mv = do let (a::String) = a --If you uncomment the next line, it will work --putStrLn $ show a putMVar mv (Just $ MyData a "toto")*

4 9

ghc-heap-view now with recursive pretty-printing
by Joachim Breitner 25 Dec '12

25 Dec '12

Hi, I get the impression that blogs and planet.haskell.org are the best way to disseminate information about new tools any more. Maybe a part of the earlier importance has been taken over by GooglePlus, but not all, leaving both blogs and GooglePlus less useful individually? Anyways, I’d like to tell you about a feature of ghc-heap-view that I have blogged about¹, namely the possibility to inspect heap values recursively in GHCi or in your programs, including thunks, the references between them and sharing: Prelude> :script /home/jojo/.cabal/share/ghc-heap-view-0.4.0.0/ghci Prelude> let x = [1..10] Prelude> x [1,2,3,4,5,6,7,8,9,10] Prelude> :printHeap x _bh [S# 1,S# 2,S# 3,S# 4,S# 5,S# 6,S# 7,S# 8,S# 9,S# 10] Note that the tools shows us that the list is a list of S# constructors, and also that it is still hidden behind a blackhole. After running System.Mem.performGC, this would disappear. Prelude> let x = Just (1 + 1) Prelude> :printHeap x Just _bco Prelude> x Just 2 Prelude> System.Mem.performGC Prelude> :printHeap x Just (S# 2) Here, we see how the calculation was deferred until forced by showing the value of x. The name _bco stands for a bytecode object as used by the interpreter. Getting useful information from them is a bit harder than for compiled thunks, so for more accurate results put the code in a Haskell source file, compile it and use the GHC.HeapView API to print the interesting parts. Prelude> let a = "hi" Prelude> let partial = (a ++) Prelude> partial "" "hi" Prelude> System.Mem.performGC Prelude> let x = (a, partial) Prelude> :printHeap x let x1 = "hi" in (x1,_fun x1) This demonstrates a partial application. The information which function is called there (++ in this case) is lost at runtime, but we still see that the second element of the tuple is a partial application of some value to the first element. Prelude> let s = "ho" Prelude> let x = cycle s Prelude> length (take 100 (show x)) 100 Prelude> System.Mem.performGC Prelude> :printHeap x let x0 = C# 'h' : C# 'o' : x0 in x0 Prelude> let y = map Data.Char.toUpper x Prelude> length (take 100 (show y)) 100 Prelude> :printHeap y C# 'H' : C# 'O' : C# 'H' : C# 'O' : C# 'H' : C# 'O' : C# 'H' : C# 'O' : C# 'H' : C# 'O' : _bh (C# 'H' : C# 'O' : C# 'H' : C# 'O' : C# 'H' : C# 'O' : C# 'H' : C# 'O' : ... : ...) The cyclic, tying-the-knot structure of cycle is very visible. But can also see how easily it is broken, in this case by mapping a function over the list. Prelude> let {x = 'H' : y ; y = 'o' : x } Prelude> length (show (take 10 x, take 10 y)) `seq` return () Prelude> System.Mem.performGC Prelude> :printHeap (x,y) let x1 = C# 'H' : x3 x3 = C# 'o' : x1 in (x1,x3) If you want to look at multiple variables at once, just pass a tuple to printHeap I hope you’ll find it useful, and I am happy to hear about other features that you might be interested in. Also, if you don’t know about it, a graphical and interactive variant of this is available as ghc-vis². Greetings, Joachim ¹ http://www.joachim-breitner.de/blog/archives/580-GHCi-integration-for-GHC.H… ² http://felsin9.de/nnis/ghc-vis/ -- Joachim "nomeata" Breitner mail(a)joachim-breitner.de | nomeata(a)debian.org | GPG: 0x4743206C xmpp: nomeata(a)joachim-breitner.de | http://www.joachim-breitner.de/

2 2

Re: [Haskell-cafe] How to fold on types?
by oleg＠okmij.org 25 Dec '12

25 Dec '12

Magiclouds asked how to build values of data types with many components from a list of components. For example, suppose we have data D3 = D3 Int Int Int deriving Show v3 = [1::Int,2,3] How can we build the value D3 1 2 3 using the list v3 as the source for D3's fields? We can't use (foldl ($) D3 values) since the type changes throughout the iteration: D3 and D3 1 have different type. The enclosed code shows the solution. It defines the function fcurry such that t1 = fcurry D3 v3 -- D3 1 2 3 gives the expected result (D3 1 2 3). The code is the instance of the general folding over heterogeneous lists, search for HFoldr in http://code.haskell.org/HList/Data/HList/HList.hs {-# LANGUAGE MultiParamTypeClasses, FlexibleInstances, FlexibleContexts #-} {-# LANGUAGE TypeFamilies, DataKinds, PolyKinds, ScopedTypeVariables #-} {-# LANGUAGE UndecidableInstances #-} -- `Folding' over the data type: creating values of data types -- with many components from a list of components -- UndecidableInstances is a bit surprising since everything is decidable, -- but GHC can't see it. -- Extensions DataKinds, PolyKinds aren't strictly needed, but -- they make the code a bit nicer. If we already have them, -- why suffer avoiding them. module P where -- The example from MagicCloud's message data D3 = D3 Int Int Int deriving Show v3 = [1::Int,2,3] type family IsArrow a :: Bool type instance IsArrow (a->b) = True type instance IsArrow D3 = False -- add more instances as needed for other non-arrow types data Proxy a = Proxy class FarCurry a r t where fcurry :: (a->t) -> [a] -> r instance ((IsArrow t) ~ f, FarCurry' f a r t) => FarCurry a r t where fcurry = fcurry' (Proxy::Proxy f) class FarCurry' f a r t where fcurry' :: Proxy f -> (a->t) -> [a] -> r instance r ~ r' => FarCurry' False a r' r where fcurry' _ cons (x:_) = cons x instance FarCurry a r t => FarCurry' True a r (a->t) where fcurry' _ cons (x:t) = fcurry (cons x) t -- Example t1 = fcurry D3 v3 -- D3 1 2 3 -- Let's add another data type data D4 = D4 Int Int Int Int deriving Show type instance IsArrow D4 = False t2 = fcurry D4 [1::Int,2,3,4] -- D4 1 2 3 4

1 0

Foreign.Erlang help
by Junior White 25 Dec '12

25 Dec '12

Hi all, I have a game server programming in erlang, but now i want to write some game logic in haskell, how to write a haskell node for erlang? ps:I have read the introduce of Foreign.Erlang,I use haskell send a message to a erlang echo server, but the server not receive anything.

2 1

Is OpenAL unqueueBuffers implemented correctly?
by alex＠tapdancinggoats.com 25 Dec '12

25 Dec '12

Hi, there's no maintainer listed for the OpenAL package, so I'm posting here in hopes of finding the right person. The unqueueBuffers function in Sound.OpenAL.AL.Source has the type Source -> [Buffer] -> IO () but I think the type should be Source -> Int -> IO [Buffer] This wraps the function alSourceUnqueueBuffers which uses the array of buffers as an output argument. With the current implementation, it's impossible to get the list of buffers that were unqueued. This implementation works the way I expect: unqueueBuffers :: AL.Source -> Int -> IO [AL.Buffer] unqueueBuffers source nbuffers = allocaArray nbuffers $ \ptr -> do alSourceUnqueueBuffers source (fromIntegral nbuffers) ptr peekArray nbuffers ptr I just started using OpenAL, so I might be misunderstanding how this is supposed to work. Thanks, Alex Midgley

1 0

Layer on a layer of record syntax in the type synonym?
by Christopher Howard 24 Dec '12

24 Dec '12

Using a simple type I gave earlier from my monadic type question... code: -------- data Socket3 a b c = Socket3 a b c deriving (Show) -------- Is it possible somehow to layer on record syntax onto a synonym of the type? The idea would be something like this... code: -------- type SpaceShip = Socket3 { engine :: Last Engine , hull :: Last Hull , guns :: [Guns] } -------- ...purely for the convenience. But this doesn't seem to work with "type" as it assumes you are referring to already made constructors, and evidently "newtype" only allows use of a single record. I could wrap it in a normal "data" declaration but that would add an extra layer of complexity I think. -- frigidcode.com

5 5

Fighting research paper bit-rot
by cheater cheater 23 Dec '12

23 Dec '12

Hi guys, after yet another episode of trying to figure out why library code doesn't make any sense when reading the related paper, I decided to start a small wiki just for the purpose of describing differences between what's in the paper and what's in the code. The first article can be found at: http://functionalpapersupdated.wikia.com/wiki/Transactional_memory_with_dat… This one was tricky: it was the "check" from stm-invariants.pdf. There is a "check" in the STM library which is a completely different function. The "check" from the paper is in another module and library and is called "alwaysSucceeds". Everyone's more than welcome to add their favourite papers and describe the differences. The wiki is freely editable. Hopefully it can, with time, grow to be of help to anyone trying to learn about Haskell or category theory or functional programming in general. I can't promise a huge amount of updates on my side (I'm just a guy learning how to use Haskell, not a researcher) but hopefully this great community can make it happen :) If you're a publishing author, and you know of such updates to your papers, please consider starting a page for your paper. It's also a good place to track the implementations of ideas described in such papers, especially in case there are multiple ones or the implementation hasn't been discussed in the paper itself.

3 3

Hint's setImports usage
by Martin Hilbig 22 Dec '12

22 Dec '12

hi, how to use Language.Haskell.Interpreter.setImports? i use it like: setImports ["My.Module"] so that my interpreted modules don't need to: import My.Module But i still get: Not in scope: data constructor `MyType' What am i doing wrong? Thanks in advance. have fun martin

2 7

Troubles with DLLs
by Henk-Jan van Tuyl 22 Dec '12

22 Dec '12

L.S., I am having troubles with DLLs; my application (Haskell, C and C++) gives several messages about DLLs not being found. I added these one by one to the current directory. At a certain point there are just error messages about null pointers and "Segmentation fault/access violation in generated code". When I try to load my application in GHCi, I get more messages about missing DLLs, up to a point where GHCi refuses to load a library because of an unknown section (a bug to be solved in GHC 7.6.2). (Several other programs have the same problem.) Now I am still stuck with a null pointer error message. 1) How can I find out which DLLs my application needs (and which package/library is to blame for it) and 2) how can I find the error location when the crash occurs in C/C++ code (it might be something else than a missing DLL of course)? My system: Windows XP + MinGW/MSYS Haskell platform 2012.4.0.0 The application uses wxHaskell. Regards, Henk-Jan van Tuyl -- http://Van.Tuyl.eu/ http://members.chello.nl/hjgtuyl/tourdemonad.html Haskell programming --

1 1

category design approach for inconvenient concepts
by Christopher Howard 22 Dec '12

22 Dec '12

Recently I read this article I happened across, about the categorical design pattern: http://www.haskellforall.com/2012/08/the-category-design-pattern.html Barely understood it, of course, but it was a rather intriguing concept. So now I'm looking at all my programming problems trying to make types that can be composed and that seem to fit the idea of a "category". However, what I'm wondering about is ideas that can be "composed" but that don't seem to fit the idea of "category", because they don't obey the associativity law. To give a specific example (pseudo code like, without any idea here of implementation or proper syntax): Say you created a type called "Component" (C for short), the idea being to compose Components out of other Components. Every C has zero or more connectors on it. Two Cs can be connected to form a new C using some kind of composition operator (say, <.>), provided there are enough connectors (one on each). Presumably you would need a "Fail" constructor of some kind to represent the situation when there is not enough connectors. Say you had a C (coupler) with two connectors, a C (thing) with one connector, and a C (gadget) with one connector. So you could have... (coupler <.> thing) <.> gadget Because the coupler and the thing would combine to create a component with one spare connector. This would then combine with the gadget to make the final component. However, if you did... coupler <.> (thing <.> gadget) Then thing and gadget combine to make a component with no spare connectors. And so the new component and the coupler then fail to combine. Associativity law broken. So, can I adjust my idea to fit the "category" concept? Or is it just not applicable here? Or am I just misunderstanding the whole concept? -- frigidcode.com

10 20

arr considered harmful
by Ryan Ingram 21 Dec '12

21 Dec '12

I know it's a bit of an 'intentionally provocative' title, but with the recent discussions on Arrows I thought it timely to bring this up. Most of the conversion from arrow syntax into arrows uses 'arr' to move components around. However, arr is totally opaque to the arrow itself, and prevents describing some very useful objects as arrows. For example, I would love to be able to use the arrow syntax to define objects of this type: data Circuit a b where Const :: Bool -> Circuit () Bool Wire :: Circuit a a Delay :: Circuit a a And :: Circuit (Bool,Bool) Bool Or :: Circuit (Bool,Bool) Bool Not :: Circuit Bool Bool Then :: Circuit a b -> Circuit b c -> Circuit a c Pair :: Circuit a c -> Circuit b d -> Circuit (a,b) (c,d) First :: Circuit a b -> Circuit (a,c) (b,c) Swap :: Circuit (a,b) (b,a) AssocL :: Circuit ((a,b),c) (a,(b,c)) AssocR :: Circuit (a,(b,c)) ((a,b),c) Loop :: Circuit (a,b) (a,c) -> Circuit b c etc. Then we can have code that examines this concrete data representation, converts it to VHDL, optimizes it, etc. However, due to the presence of the opaque 'arr', there's no way to make this type an arrow without adding an 'escape hatch' Arr :: (a -> b) -> Circuit a b which breaks the abstraction: circuit is supposed to represent an actual boolean circuit; (Arr not) is not a valid circuit because we've lost the information about the existence of a 'Not' gate. The arrow syntax translation uses arr to do plumbing of variables. I think a promising project would be to figure out exactly what plumbing is needed, and add those functions to a sort of 'PrimitiveArrow' class. All of these plumbing functions are trivially implemented in terms of 'arr', when it exists, but if it doesn't, it should be possible to use the arrow syntax regardless. -- ryan

9 13

MPTC or functional dependencies?
by Petr P 21 Dec '12

21 Dec '12

Dear Haskellers, I'm working on a small library for representing semigroup (or monoid) actions on a set <http://hackage.haskell.org/package/semigroups-actions>. The MultiParamTypeClasses extension seems to be best suited for the task, as a group can act on many sets, and a set can be acted on by different groups: -- | Represents an action of semigroup @g@ to set @a@. -- -- Laws: @'Endo' . 'act'@ must be a homomorphism of semigroups. class Semigroup g => SemigroupAct g a where act :: g -> (a -> a) But soon I realized that with MPTC the compiler has problems inferring types and I had to explicitly specify types when using `act` in many places. Because it seems that in most cases a set will have only a single group acting on it, I was thinking about using FDs: class Semigroup g => SemigroupAct g a | a -> g where But on the other hand, this can limit the generality of the type class. I cannot decide which one I should choose. What would you suggest? According to your experience, would you choose plain MPTC or FD? Best regards, Petr Pudlak

3 3

monoid pair of monoids?
by Christopher Howard 21 Dec '12

21 Dec '12

In my current pondering of the compose-able objects them, I was thinking it would be useful to have the follow abstractions: Monoids, which were themselves tuples of Monoids. The idea was something like so: code: -------- import Data.Monoid instance Monoid (Socket2 a b) where mempty = Socket2 (mempty, mempty) Socket2 (a, b) `mappend` Socket2 (w, x) = Socket2 (a `mappend` w, b `mappend` x) data Socket2 a b = Socket2 (a, b) -------- However, this does not compile because of errors like so: code: -------- Sockets.hs:9:21: No instance for (Monoid a) arising from a use of `mempty' In the expression: mempty In the first argument of `Socket2', namely `(mempty, mempty)' In the expression: Socket2 (mempty, mempty) -------- This makes sense, but I haven't figured out a way to rewrite this to make it work. One approach I tried was to encode Monoid constraints into the data declaration (which I heard was a bad idea) but this didn't work, even using forall. Also I tried to encode it into the instance declaration, but the compiler kept complaining about errant or illegal syntax. -- frigidcode.com

5 5