- Haskell-Cafe - Haskell.org

ANNOUNCE: HaNS-2.1.0.0
by Trevor Elliott 24 May '11

24 May '11

Galois, Inc. is pleased to announce the release of HaNS, the Haskell Network Stack. HaNS is a lightweight, pure Haskell network stack that can be used for Haskell networking in the context of the HaLVM, or with a Linux tap device. Currently, HaNS supports 802.3, IPv4, ARP, DHCP (partially), ICMP, UDP, and TCP. On Hackage: http://hackage.haskell.org/package/HaNS Git repo: http://code.galois.com/cgi-bin/gitweb The TCP component is a port of Peng Li and Stephan Zdancewic's Haskell TCP library, which in turn was translated from Norrish et al's HOL4 TCP specification. What might you use HaNS for? Developing new and interesting networking protocols, at any layer of the network stack, or your own variants of existing protocols. HaNS allows HaLVM nodes to support networking, meaning you can run experimental network services directly on top of the HaLVM (without any pesky OS getting in the way). There are probably lots of other cool applications of HaNS we haven't though of yet. HaNS is released under a BSD license, and should be considered experimental at this stage. If you have any questions please contact the HaLVM team at halvm-devel(a)community.galois.com. -- Trevor Elliott (for the HaLVM team) P.S. If you're building with the HaLVM, make sure to add -fhalvm to your cabal install invocation. = References = HaLVM: http://halvm.org Haskell TCP: http://hackage.haskell.org/package/tcp

1 0

Hackage internal server error
by Niklas Broberg 24 May '11

24 May '11

nibro@nibro-laptop:~/src/haskell-src-exts$ cabal sdist Building source dist for haskell-src-exts-1.11.1... Preprocessing library haskell-src-exts-1.11.1... Source tarball created: dist/haskell-src-exts-1.11.1.tar.gz nibro@nibro-laptop:~/src/haskell-src-exts$ cabal upload dist/haskell-src-exts-1.11.1.tar.gz Hackage username: NiklasBroberg Hackage password: Uploading dist/haskell-src-exts-1.11.1.tar.gz... Error: dist/haskell-src-exts-1.11.1.tar.gz: 500 Internal Server Error 500 Internal Server Error <stdin>: hWaitForInput: invalid argument (Invalid or incomplete multibyte or wide character) nibro@nibro-laptop:~/src/haskell-src-exts$ Hackage's fault, cabal's fault, or (*gasp*) mine? Cheers, /Niklas

2 1

Cabal: disabling -fvia-C
by Jacek Generowicz 24 May '11

24 May '11

I hope you will pardon another *ignorant* question. 'cabal install lambdabot' fails on Ubuntu Natty. According to the following exchange and bug report http://comments.gmane.org/gmane.comp.lang.haskell.cafe/88735 http://hackage.haskell.org/trac/ghc/ticket/5050 the workaround is not to use -fvia-C. I have found an {-# OPTION -fvia-C #-} deep inside the lambdabot code in Plugin/Pl/Common.hs. How can I tell cabal install to ignore this? Is there some command line option for doing so, or do I have to edit the source code and somehow persuade cabal to use my hacked version ?

3 4

GHC 7, Platform 2011.2 vs OS X 10.5, Ubuntu 11.04
by Jacek Generowicz 24 May '11

24 May '11

[TL;DR: there's a concrete question at the bottom.] Once again I find myself in the pleasant situation where the slings and arrows of life in general are slightly less intense, and I manage to find a few spare minutes and some free brain cycles to dedicate to Haskell. Why not try GHC 7.0.3? (after all, GHC 7 has been out for a good few months, so the teething troubles should have passed by now), and there's a lovely new Haskell Platform 2011.2.0.1 to go with it, so, maybe this time, I'll actually be able to use some of the libraries that I tried and failed to install during my last period of Haskell study. The two computers I have available for playing with Haskell run OS X Leopard (10.5), and Ubuntu Natty (11.04). First up OS X: It seems that GHC 7 (and consequently Platform 2011.2) require OS X 10.6. OK, let's forget that one. Next up: Ubuntu. There's a Linux Link on the Haskell Platform Page. Ooooh, there's an Ubuntu link. Ooooh! there's even a package for Natty, great! Version 2010.1.0.0.1 WTF? Where's the 2011.2 package? There isn't one. OOoooKaaaayyyy. Any workarounds. Well, we can install from source, apparently. But we need GHC 7.0.3 first. Fine. Done. Now let's install the platorm. [Does obvious thing, compilation fails.] Hmm, let's follow the "Complete instructions for installing from source" http://www.vex.net/~trebla/haskell/haskell-platform.xhtml just in case I did something stupid. [Follows instructions: failure.] OK, maybe something somewhere is causing some confusion with previously installed versions of GHC, Cabal, whatever. [Performs Haskell pogrom on system: removes all traces of anything Haskell related. Follows "Complete instructions [...]" WORD ... FOR ... WORD. Failure]. Aaaaaaaaaaaaaaaaaaaargh ! I can't take it any more. I just want to write some Haskell, and every time I want to venture beyond the safe confines of the Prelude I get bogged down in installation hell. Next time I have some spare time, I will be more reluctant to risk having that time stolen by the Haskell infrastructure installation process. So, after this tale of agony, here are two concrete questions: a) Am I right in concluding that GHC 7.0.3 will not run on OS X 10.5 (without unreasonable effort)? b) On Ubuntu Natty I installed the generic linux GHC 7.0.3 binary. Downloaded Haskell Platform 2011.2.0.1 source distribution. ./ configure worked happily. make fails as follows. Building transformers-0.2.2.0 "/usr/local/haskell-platform-2011.2.0.1/bin/ghc" "--make" "Setup" "-o" "Setup" "-package" "Cabal-1.10.1.0" <command line>: cannot satisfy -package Cabal-1.10.1.0: Cabal-1.10.1.0-1fb2094e19492373b1a39284193e7984 is unusable due to missing or recursive dependencies: process-1.0.1.5-55dfaccf3a91c4cb8f6284a0bafef198 Could anybody help me get past this problem?

6 17

SIGSEGV in yieldCapability ()
by Johannes Waldmann 24 May '11

24 May '11

Hi. What would be the reason for Program received signal SIGSEGV, Segmentation fault. 0x00000000006071de in yieldCapability () (gdb) where #0 0x00000000006071de in yieldCapability () #1 0x000000000060bc6b in schedule () #2 0x0000000000609294 in real_main () #3 0x000000000060938d in hs_main () #4 0x00007ffff6b07eff in __libc_start_main () from /lib/x86_64-linux-gnu/libc.so.6 #5 0x000000000040a589 in _start () this happens in a program compiled with ghc-7.0.3 (and also, with ghc-6.12.3), running with +RTS -N on i7-920, ubuntu 11 (kernel 2.6.38-8) Could this simply mean "heap exhausted"? Thanks - J.W.

4 4

Bytestring package: Int and Int64
by Daniel Díaz 24 May '11

24 May '11

Hi, cafe, I just feel curiosity. In the bytestring package, Data.ByteString module, functions like length, index, and others with Int in its type signature, have Int64 in the analogous Data.ByteString.Lazy version. What is the reason? -- Daniel Díaz

2 2

Cabal: top level dependency base -any
by Jacek Generowicz 24 May '11

24 May '11

Hi, Could anyone shed light on the meaning of this error message? cabal: cannot configure xmonad-0.9.1 It requires base ==3.* For the dependency on base ==3.* there are these packages: base-3.0.3.1 and base-3.0.3.2. However none of them are available. base-3.0.3.1 was excluded because of the top level dependency base -any base-3.0.3.2 was excluded because of the top level dependency base -any My guess is that "-any" would mean either that any version is acceptable (in which case should always work, including this time) or that "-any" means that any version is unacceptable, in which case it would never work, which is daft. So clearly I don't understand what it is trying to say. Any hints? Is this documented anywhere? Thanks.

3 6

Imports in complex Setup.hs -- should we encourage/require PackageImports?
by John Millikin 24 May '11

24 May '11

Several libraries (notably Pandoc and Gtk2hs) have very complex Setup.hs scripts, which import several external libraries. In my experience, these imports are very fragile, because Cabal does not enforce package visibility in Setup.hs. For example, a Setup.hs that imports Control.Monad.Trans will break if "monads-tf" is installed, and one that imports System.FilePath will break if "system-filepath" is installed. My typical solution when this happens is to manually tweak the GHC package database before installing, but this is annoying and does not help other users. Based on a ticket in Cabal's Trac < http://hackage.haskell.org/trac/hackage/ticket/326 >, custom Setup.hs scripts are discouraged by the Cabal developers. I assume this means there will not be much development effort put towards an integrated solution (such as using -hide-all-packages and build-depends: when compiling Setup.hs). A possible solution is to ask developers with complex Setup.hs requirements to use the PackageImports language extension when importing external libraries. However, this places a burden on such developers, and I don't know if it's portable to non-GHC compilers. It would also need an analysis of currently published Hackage packages to see which have such scripts. Any ideas/comments? Has anyone by chance found a good solution to this?

2 1

Further installation adventures
by Jacek Generowicz 23 May '11

23 May '11

I'm trying to cabal install lambdabot. This depends on a squillion other libraries, which cabal tries to install, among which is readline, which fails to configure as follows. Configuring readline-1.0.1.0... checking for gcc... gcc checking for C compiler default output file name... a.out checking whether the C compiler works... yes checking whether we are cross compiling... no checking for suffix of executables... checking for suffix of object files... o checking whether we are using the GNU C compiler... yes checking whether gcc accepts -g... yes checking for gcc option to accept ISO C89... none needed checking for GNUreadline.framework... checking for readline... no checking for tputs in -lncurses... no checking for tputs in -ltermcap... no checking for tputs in -lcurses... no checking for rl_readline_version... no configure: error: readline not found, so this package cannot be built See `config.log' for more details. cabal: Error: some packages failed to install: readline-1.0.1.0 failed during the configure step. The exception was: ExitFailure 1 From which I conclude that it can't find the readline library. I have all sorts of flavours of readline on my system, so I'll need a bit more information about what exactly it's looking for. It tells me to look in config.log. I presume that this is the config log of the cabal package readline, which cabal automatically downloaded, unpacked ... and presumably automatically cleaned up at the end, because I can't find it anywhere. Where should I be looking for the relevant config.log?

2 2

The Lisp Curse
by Andrew Coppin 23 May '11

23 May '11

http://www.winestockwebdesign.com/Essays/Lisp_Curse.html Some of you might have seen this. Here's the short version: Lisp is so powerful that it discourages reuse. Why search for and reuse an existing implementation, when it's so trivially easy to reimplement exactly what you want yourself? The net result is a maze of incompatible libraries which each solve a different 80% of the same problem. To all the people who look at Hackage, see that there are 6 different libraries for processing Unicode text files, and claim that this is somehow a *good* thing, I offer the above essay as a counter-example.

27 37

blaze-builder and FlexibleInstances in code that aims to become part of the Haskell platform
by Simon Meier 23 May '11

23 May '11

Hello Haskell-Cafe, my main question is whether requiring FlexibleInstances is a problem for code that aims to become part of the Haskell platform. The following explanation gives the context for this question. As some of you may know the blaze-builder library is now used in quite a few places. That's nice, but it doesn't mean that blaze-builder is a finished solution to the problem of providing an API for high-performance buffered output (creation of chunked representations) of sequences of bytes. In fact, one of my current goals with this work is to polish it such that it can be integrated into the 'bytestring' library. This has the benefit that functions that create lazy bytestrings (e.g., pack, map, unfoldr, filter) can be implemented such that they create well-sized chunks even if the argument bytestring is hugely fragmented. Moreover, this integration also establishes a single builder type as the output representation. Therefore, other creators of bytestrings (e.g., 'text', 'base16-bytestring', 'zlib') can provide results of type Builder, which enables O(1) appends of their results and the preservation of well-sizedness of the created chunks. As part of this goal, I'm currently working on the first of the following three points that are paramount to achieving great encoding performance: 1. Ensure that individual Haskell values are encoded with minimal overhead. 2. Ensure that concatenation of sequences of bytes is efficient. 3. Ensure that the average chunk size is large. The core principle used to tackle (1) is avoiding intermediate data structures. The core abstraction used is the one of a Write (see [1] for the corresponding library.) data Write a = Write Int (a -> Ptr Word8 -> IO (Ptr Word8)) A value `Write bound io :: Write a` denotes an encoding scheme for values of type `a` that uses at most `bound` bytes space. Given a values `x :: a` and a pointer `po` to the next free byte `io x po` encodes `x` to memory starting from `po` and returns the pointer to the next free byte after the encoding of `x`. In most cases Writes are used as an abstract datatype. They serve as an interface between implementors of the low-level bit-twiddling required to efficiently implement encodings like UTF-8 or Base16 and the providers of efficient traversal functions through streams of Haskell values. Hence, typical users of Writes are functions like fromWrite :: Write a -> a -> Builder fromWriteList :: Write a -> [a] -> Builder fromWriteUnfoldr :: Write b -> (a -> Maybe (b, a)) -> a -> Builder mapWriteByteString :: Write Word8 -> S.ByteString -> Builder They consume the given datastructure efficiently and wrap the Writes in the bounds checking code to detect when a buffer is full and request a new one. There are many providers of Writes. Each bounded-length-encoding of a standard Haskell value is likely to have a corresponding Write. For example, encoding an Int32 as a big-endian, little-endian, and host-endian byte-sequence is currently achieved with the following three functions. writeInt32BE :: Write Int32 writeInt32LE :: Write Int32 writeInt32HE :: Write Int32 I would like to avoid naming all these encodings individually. Especially, as the situation becomes worse for more elaborate encodings like hexadecimal encodings. There, we encounter encodings like the utf8-encoding of the hexadecimal-encoding with lower-case letters of an Int32. writeInt32HexLowerUtf8 :: Write Int32 I really don't like that. Therefore, I'm thinking about the following solution based on type-classes. We introduce a single typeclass class Writable a where write :: Write a and use a bunch of newtypes to denote our encodings. newtype Ascii7 a = Ascii7 { unAscii7 :: a } newtype Utf8 a = Utf8 { unUtf8 :: a } newtype HexUpper a = HexUpper { unHexUpper :: a } newtype HexLower a = HexLower { unHexLower :: a } ... Assuming FlexibleInstnaces, we can write encodings like the above hex-encoding as instances instance Write (Utf8 (HexLower Int32)) where write = ... This composes rather nicely and allows the implementations to exploit special properties of the involved data. For example, if we also had a HTML escaping marker newtype Html a = Html { unHtml :: a } Then, the instance instance Write (Utf8 (HTML (HexLower Int32))) where write (Utf8 (HTML (HexLower i))) = write (Utf8 (HexLower i)) exploits that no HTML escaping is required for a hex-number. Assuming FlexibleContexts, the user can also build abbreviations for builders using fixed encodings. utf8 :: Writable (Utf8 a) => a -> Builder utf8 = fromWrite write . Utf8 Note that, on the Builder level, a probably better way would be to have an analogous 'ToBuilder' typeclass to abstract the various encodings. Part of these instances then reuse the corresponding instances from Writable. I think this type-class based interface to select the correct efficient implementation of an encoding is rather nice. However, I don't know if 'FlexibleInstances' and 'FlexibleContexts' are fine to use in code that aims to become part of the Haskell platform. Moreover, I might well overlook some drawbacks of this design. I'm looking forward to your feedback. best regards, Simon [1] https://github.com/meiersi/system-io-write

7 17

Handling a large database (of ngrams)
by Aleksandar Dimitrov 23 May '11

23 May '11

Hi Haskellers, I'm unaware of a "good method" or "default way" of handling large datasets to which I need non-sequential (i.e. random) access in Haskell. My use case is linguistic analysis of a ~30GB corpus — the most basic form of quantitative analysis here are ngram based HMMs, which aren't difficult to pull of in Haskell. However, I would need a *large* database of ngrams, possibly into the hundreds of gigabytes. Such a beast will obviously never fit into memory. Moreover, I'll need sort of random access both during training and testing/operation. My initial idea (that I'm currently following up on) is to use Haskell's Berkeley DB wrapper. In this case, I would just stuff all ngrams in one big table (with their counts in an associated column,) and let Berkeley DB do the heavy lifting. One simplifying assumption is, of course, using the flyweight pattern (i.e. having one table of unigrams (that would even fit into memory!) associated with indices, and then just reference the indices in the ngram table.) But this is only going to decrease the size of the db by some factor, not an order of magnitude. Tries come to mind, too. Not only for the unigram table (where they indeed do make a lot of sense,) but also for the ngram table, where they might or might not help. In this case, the cells of the trie would be word indices pointing to the unigram table. Is there a way to serialize tries over a finite (but possibly large) domain to disk and have a semi-speedy random access to them? I'm fully aware that I'll have to wait up to a couple of seconds per lookup, that's OK. I could hack together a primitive implementation of what I need here, but maybe there's something better out there already? Hackage didn't speak to me[1], and #haskell was busy discussing something else, so I hope -cafe can help me :-) Thanks for any hints and pointers! Aleks [1] There's the ngram package on Haskell, but that only queries Google. I actually want to build my own ngram database, because I'm training on a specific corpus, and will possibly have to adapt to different domains.

2 3

Is there an efficient way to generate Euler's totient function for [2, 3..n]?
by KC 22 May '11

22 May '11

Is there an efficient way to generate Euler's totient function for [2,3..n]? Or an arithmetical sequence? Or a geometric sequence? Or some generalized sequence? -- -- Regards, KC

4 5

ANNOUNCE: wl-pprint-text 1.0.0.0
by Ivan Lazar Miljenovic 22 May '11

22 May '11

And lo, the people of Haskell hath declared that the text [1] library was to be the One True Way of dealing with textual data (unless, of course, you're annoyed about it using UTF-16 instead of UTF-8). And yet there was much sadness in the land, for there was no pretty-printing library available to produce said Text values, meaning that it was difficult for supplicants to produce the formatting their form of praise required. A voice then spake: make ye a new pretty-printing library aimed specifically for Text values. But thou shall not use the API from pretty [2], as it is rather limited. Instead, the design of wl-pprint [3] looks Real Good! It has more combinators available, can neatly deal with wrapping lists, and also has support for producing output for both humans and the machines that serve us so well! Thus were mighty energies aimed at producing such a library. Many were the hour at which toil was spent on this task, but at long last the task was completed. Yet great evil (i.e. programmer laziness) befell the great task, and it lay hidden for many a moon. However, with much effort the project was recovered, and is now available for all! [4] Some changes were regrettably required to achieve this task. The most important of which was that it was discovered that wl-pprint may not be as perfect as all that, in that documents of no content were treated poorly. However, spects of the pretty package were able to redeem themselves by supplying the necessary functionality. However, the great task was able to extend upon that which was there before, by invoking the almighty powers of the Monad. TL;DR: wl-pprint-text is a pretty-printing package for lazy Text values based upon the API of wl-pprint. It however deals with the nil document better than wl-pprint does, and also has a version where all the comibnators are lifted into a Monad, primarily so that it can be used within a State Monad. [1]: http://hackage.haskell.org/package/text [2]: http://hackage.haskell.org/package/pretty [3]: http://hackage.haskell.org/package/wl-pprint [4]: http://hackage.haskell.org/package/wl-pprint-text -- Ivan Lazar Miljenovic Ivan.Miljenovic(a)gmail.com IvanMiljenovic.wordpress.com

1 0

ScopedTypeVariables in let-bindings (not where-bindings!) and bug 4347
by Paolo G. Giarrusso 21 May '11

21 May '11

Hi all, I have some problem with ScopedTypeVariables, let and so on, at least in GHC 7. My aim is to be able to supply a polymorphic type signature in let bindings. Confusingly, I find no such example in the blog post about local let generalization [1]. I first met this problem when porting some test-code from Kiselyov, when refusing to convert its let- bindings into where-bindings (which, btw, can't be typed into GHCi). I've also added a comment to the bug report, but it's still quite possible that I'm missing something. == Summary == My starting point today: I wanted to test polymorphic recursion by entering this definition into GHCi: a :: a -> a a = a a This is accepted without extra language pragmas but only with the type signature, due to the use of polymorphic recursion for which type inference is undecidable. To type it into GHCi I need to supply a polymorphic type in a let- binding. However, it turns out that Prelude> let id2 :: Int -> Int = \x -> x works but there's no way whatsoever to make the following work: Prelude> let (id2 :: forall t. t -> t) = \x -> x because of bug 4347. But let's start from the beginning. == Walk-through, with various other complaints. == So let's try this: $ ghci -XScopedTypeVariables Prelude> let a :: forall b. b -> b = a a [...request of enabling -XRank2Types or -XRankNTypes, confusing or BUGGY because the type is rank-1 ...] Prelude> :set -XRank2Types Prelude> let a :: forall b. b -> b = a a <interactive>:1:31: Couldn't match expected type `forall b. b -> b' with actual type `b0 -> b0' In the first argument of `a', namely `a' In the expression: a a In a pattern binding: a :: forall b. b -> b = a a Uh? That's strange. Seems an instance of bug #4347, but the error message is not yet the same. To get that, let's make an easier example: id. Of course, it needs no type signature, but if one can't give to this an explicit signature, realistic examples are hopeless. So, at the GHCi 7.0.3 prompt, I can't type: Prelude> let id2 :: t -> t = \x -> x GHCi first suggests using -XScopedTypeVariables. Let's try that: Prelude> :set -XScopedTypeVariables Prelude> let (id2 :: Int -> Int) = \x -> x This monomorphic function is fine, but the original polymorphic one is not accepted, it complains that t is not in scope - fine, let's add forall: *Main> let (id :: forall t. t -> t) = \x -> x <interactive>:1:6: Illegal polymorphic or qualified type: forall t. t -> t Perhaps you intended to use -XRankNTypes or -XRank2Types In a pattern type signature: forall t. t -> t In the pattern: id :: forall t. t -> t In a pattern binding: (id :: forall t. t -> t) = \ x -> x This is already confusing for me - the intended type is rank-1. But let's listen to GHCi again: Prelude> :set -XRank2Types Now, the error message is really puzzling: Prelude> let (id2 :: forall t. t -> t) = \x -> x <interactive>:1:33: Couldn't match expected type `t0 -> t1' with actual type `forall t. t -> t' The lambda expression `\ x -> x' has one argument, but its type `forall t. t -> t' has none In the expression: \ x -> x In a pattern binding: (id2 :: forall t. t -> t) = \ x -> x What's up? The documentation never mention let, but it does mention type signatures for patterns [2], and in "let a = b in c", "a" is IIRC a considered a pattern. Still, the lack of examples with let is already confusing. id2 :: forall t. t -> t = \x -> x How does "forall t. t -> t" have no argument? At worst, it expects a type-argument, in its System F representation . The only implementation problem I see in this code is that unification must "see through" the forall. I've seen this behavior described [3, 4], but all the problematic examples have been fixed in some way. Here, I see no direct fix. Best regards Paolo G. Giarrusso [1] http://hackage.haskell.org/trac/ghc/blog/LetGeneralisationInGhc7 [2] http://www.haskell.org/ghc/docs/7.0.3/html/users_guide/other-type-extension… [3] http://stackoverflow.com/questions/5885479/weird-error-when-using-scoped-ty… [4] http://hackage.haskell.org/trac/ghc/ticket/4347

6 12

Can't access map value with key.
by michael rice 21 May '11

21 May '11

What am I doing wrong in the last line of main? If I comment out the last line of main, my program prints the map (mp) that is created. If I leave it in, the program fails. The last line should print the list ["I"]. Michael ================================================ import Control.Monad.Stateimport Data.Map type Prefix = (String,String)type GeneratorState = State ((Map Prefix [String]),Prefix,[String]) non_word = "\n" f key new old = new ++ old buildMap :: GeneratorState (Map Prefix [String])buildMap = do (mp,(pfx1,pfx2),words) <- get if (Prelude.null words) then {- No more words. Return final map (adding non_word for prefix). -} return (insertWithKey' f (pfx1,pfx2) [non_word] mp) else do {- Add word to map at prefix & continue. -} put (insertWithKey' f (pfx1,pfx2) [head words] mp, (pfx2,(head words)), tail words) buildMap {-*Main> execState buildMap (singleton ("\n","\n") [], ("\n","\n"), ["I","am","lost."])(fromList [(("\n","\n"),["I"]),(("\n","I"),["am"]),(("I","am"),["lost."])],("am","lost."),[])*Main> -} nwords = 1 main = do contents <- getContents let mp = execState buildMap (singleton (non_word,non_word) [], (non_word,non_word), words contents) putStrLn $ show mp putStrLn $ show (mp ! (non_word,non_word)) ============================================== [michael@hostname ~]$ ghc --make markov4.hs[1 of 1] Compiling Main ( markov4.hs, markov4.o )Linking markov4 ...[michael@hostname ~]$ echo "I am lost." | ./markov4(fromList [(("\n","\n"),["I"]),(("\n","I"),["am"]),(("I","am"),["lost."])],("am","lost."),[])[michael@hostname ~]$ ghc --make markov4.hs[1 of 1] Compiling Main ( markov4.hs, markov4.o ) markov4.hs:35:27: Couldn't match expected type `Map k a' against inferred type `(Map Prefix [String], Prefix, [String])' In the first argument of `(!)', namely `mp' In the first argument of `show', namely `(mp ! (non_word, non_word))' In the second argument of `($)', namely `show (mp ! (non_word, non_word))'[michael@hostname ~]$

2 4

ghc error when I use MissingH
by Siddharth Karandikar 21 May '11

21 May '11

I am following an article by John Goerzen - http://www.freesoftwaremagazine.com/articles/haskell# Here, the very first example uses MissingH library. As I have ghci 7.0.3 and haskell-platform installed, I quickly installed this library using cabal. But ghc fails to find it. Here are the errors that I get - siddharth@mars:~/myprogs/hs$ ghc --make -o mh1 mh1.hs -v Glasgow Haskell Compiler, Version 7.0.3, for Haskell 98, stage 2 booted by GHC version 6.12.1 Using binary package database: /home/siddharth/tools/ghc/ghc-7.0.3/lib/ghc-7.0.3/package.conf.d/package.cache Using binary package database: /home/siddharth/.ghc/i386-linux-7.0.3/package.conf.d/package.cache wired-in package ghc-prim mapped to ghc-prim-0.2.0.0-6bf7b03ebc9c668817e4379b6796c0c2 wired-in package integer-gmp mapped to integer-gmp-0.2.0.3-91607778cf3ae8f3948a50062b4f8479 wired-in package base mapped to base-4.3.1.0-cf5fbbf5ccbd0475ad054efbb121340e wired-in package rts mapped to builtin_rts wired-in package template-haskell mapped to template-haskell-2.5.0.0-f0c8f015e470d561d64a578434331367 wired-in package dph-seq not found. wired-in package dph-par not found. Hsc static flags: -static *** Chasing dependencies: Chasing modules from: *mh1.hs mh1.hs:1:8: Could not find module `MissingH.List': locations searched: MissingH/List.hs MissingH/List.lhs *** Deleting temp files: Deleting: *** Deleting temp dirs: Deleting: Thanks, Siddharth

2 2

Extension for "Pearls of Functional Algorithm Design" by Richard Bird, 2010, page 25 #Haskell
by KC 21 May '11

21 May '11

Extension for "Pearls of Functional Algorithm Design" by Richard Bird, 2010, page 25 #Haskell ------------------------------------------------------------------------------- ------------------------------------------------------------------------------- module SelectionProblem where import Data.Array import Data.List ------------------------------------------------------------------------------- ------------------------------------------------------------------------------- -- Question: is there a way to get the type signature as the following: -- smallest :: (Ord a) => Int -> [Array Int a] -> a ------------------------------------------------------------------------------- ------------------------------------------------------------------------------- -- Works on 2 finite ordered disjoint sets represented as sorted arrays. smallest :: (Ord a) => Int -> (Array Int a, Array Int a) -> a smallest k (xa,ya) = search k (xa,ya) (0,m+1) (0,n+1) where (0,m) = bounds xa (0,n) = bounds ya -- Removed some of the "indexitis" at the cost of calling another function. search :: (Ord a) => Int -> (Array Int a, Array Int a) -> (Int,Int) -> (Int,Int) -> a search k (xa,ya) (lx,rx) (ly,ry) | lx == rx = ya ! (k+ly) | ly == ry = xa ! (k+lx) | otherwise = case (xa ! mx < ya ! my) of (True) -> smallest2h k (xa,ya) ((lx,mx,rx),(ly,my,ry)) (False) -> smallest2h k (ya,xa) ((ly,my,ry),(lx,mx,rx)) where mx = (lx+rx) `div` 2 my = (ly+ry) `div` 2 -- Here the sorted arrays are in order by their middle elements. -- Only cutting the leading or trailing array by half. -- Here xa is the first array and ya the second array by their middle elements. smallest2h :: (Ord a) => Int -> (Array Int a, Array Int a) -> ((Int,Int,Int),(Int,Int,Int)) -> a smallest2h k (xa,ya) ((lx,mx,rx),(ly,my,ry)) = case (k<=mx-lx+my-ly) of (True) -> search k (xa,ya) (lx,rx) (ly,my) (False) -> search (k-(mx-lx)-1) (xa,ya) (mx+1,rx) (ly,ry) ------------------------------------------------------------------------------- ------------------------------------------------------------------------------- -- Works on 3 finite ordered disjoint sets represented as sorted arrays. smallest3 :: (Ord a) => Int -> (Array Int a, Array Int a, Array Int a) -> a smallest3 k (xa,ya,za) = -- On each recursive call the order of the arrays can switch. search3 k (xa,ya,za) (0,bx+1) (0,by+1) (0,bz+1) where (0,bx) = bounds xa (0,by) = bounds ya (0,bz) = bounds za -- Removed some of the "indexitis" at the cost of calling another function. search3 :: (Ord a) => Int -> (Array Int a, Array Int a, Array Int a) -> (Int,Int) -> (Int,Int) -> (Int,Int) -> a search3 k (xa,ya,za) (lx,rx) (ly,ry) (lz,rz) | lx == rx && ly == ry = za ! (k+lz) | ly == ry && lz == rz = xa ! (k+lx) | lx == rx && lz == rz = ya ! (k+ly) | lx == rx = search k (ya,za) (ly,ry) (lz,rz) | ly == ry = search k (xa,za) (lx,rx) (lz,rz) | lz == rz = search k (xa,ya) (lx,rx) (ly,ry) | otherwise = case (xa ! mx < ya ! my, xa ! mx < za ! mz, ya ! my < za ! mz) of (True, True, True) -> smallest3h k (xa,ya,za) ((lx,mx,rx),(ly,my,ry),(lz,mz,rz)) -- a<b<c (True, True, False) -> smallest3h k (xa,za,ya) ((lx,mx,rx),(lz,mz,rz),(ly,my,ry)) -- a<c<b (False, True, True) -> smallest3h k (ya,xa,za) ((ly,my,ry),(lx,mx,rx),(lz,mz,rz)) -- b<a<c (False, False, True) -> smallest3h k (ya,za,xa) ((ly,my,ry),(lz,mz,rz),(lx,mx,rx)) -- b<c<a (True, False, False) -> smallest3h k (za,xa,ya) ((lz,mz,rz),(lx,mx,rx),(ly,my,ry)) -- c<a<b (False, False, False) -> smallest3h k (za,ya,xa) ((lz,mz,rz),(ly,my,ry),(lx,mx,rx)) -- c<b<a where mx = (lx+rx) `div` 2 my = (ly+ry) `div` 2 mz = (lz+rz) `div` 2 -- Here the sorted arrays are in order by their middle elements. -- Only cutting the leading or trailing array by half. -- Here xa is the first array, ya the second array, and za the third array by their middle elements. smallest3h :: (Ord a) => Int -> (Array Int a, Array Int a, Array Int a) -> ((Int,Int,Int),(Int,Int,Int),(Int,Int,Int)) -> a smallest3h k (xa,ya,za) ((lx,mx,rx),(ly,my,ry),(lz,mz,rz)) = case (k<=mx-lx+my-ly+mz-lz) of (True) -> search3 k (xa,ya,za) (lx,rx) (ly,ry) (lz,mz) (False) -> search3 (k-(mx-lx)-1) (xa,ya,za) (mx+1,rx) (ly,ry) (lz,rz) -- -- Regards, KC

2 1

"In several chapters there is a penetrating conceptual analysis of the matter at hand, on which a superstructure of code is erected."
by KC 21 May '11

21 May '11

Interesting comment on the book "The Fun of Programming" in JOOP. "In several chapters there is a penetrating conceptual analysis of the matter at hand, on which a superstructure of code is erected." -- -- Regards, KC

1 0

Is there a place where we can have a discussion on the merits of various GUI's & various graphics? And then vote?
by KC 20 May '11

20 May '11

:) -- -- Regards, KC

1 1

。就qhyrdvefhvfgyvvr，fhfxuhxxyvvhvvvvvghvvvvvrvvvvvvvvevx。
by andrew 20 May '11

20 May '11

466

1 0

Reverse Show instance
by Andrew Coppin 20 May '11

20 May '11

Cannot deduce (Show x) from context (Show (x, y)). Cannot deduce (Show y) from context (Show (x, y)). Um... seriously? From Prelude, we have Show x, Show y => Show (x, y) So clearly it works in the forward direction. But apparently not in the reverse direction. Is this a bug or a feature? (I.e., is there some obscure possibility I haven't thought of which means that doing the reverse inference would be incorrect?)

5 5

Trying to return a map from State monad
by michael rice 19 May '11

19 May '11

I'm not sure what's going on BELOW. Was working with mapAccumL earlier and decided to move over to State monad for more control. :m + Data.Map:m + Data.ListPrelude Data.List Data.Map> let f key new old = new ++ oldPrelude Data.List Data.Map> let moby2 = "Moby Dick is a great book. Moby Dick was a white whale."Prelude Data.List Data.Map> fst $ mapAccumL (\ (m,p) w -> ((insertWithKey' f p [w] m, (snd p, w)),"")) (singleton ("\n", "\n") [], ("\n","\n")) (words moby2)(fromList [(("\n","\n"),["Moby"]),(("\n","Moby"),["Dick"]),(("Dick","is"),["a"]),(("Dick","was"),["a"]),(("Moby","Dick"),["was","is"]),(("a","great"),["book."]),(("a","white"),["whale."]),(("book.","Moby"),["Dick"]),(("great","book."),["Moby"]),(("is","a"),["great"]),(("was","a"),["white"])],("white","whale.")) Michael BELOW=========================== import Control.Monad.Stateimport Data.Map type Prefix = (String,String)type GeneratorState = (Map Prefix [String],Prefix,[String]) non_word = "\n" f key new old = new ++ old buildMap :: GeneratorState (Map Prefix [String]) buildMap = do (mp,(pfx1,pfx2),all@(w1:words)) <- get if (Prelude.null all) then {- No more words. Return final map (adding non_word for prefix). -} return (insertWithKey' f (pfx1,pfx2) [non_word] mp) else {- Add word to map at prefix. Continue. -} put (insertWithKey' f (pfx1,pfx2) [w1] mp, (pfx2,w1), words) buildMap ========================== Prelude> :l markov3.hs[1 of 1] Compiling Main ( markov3.hs, interpreted ) markov3.hs:11:12: `GeneratorState' is applied to too many type arguments In the type signature for `buildMap': buildMap :: GeneratorState (Map Prefix [String])Failed, modules loaded: none.

3 5

where is it appropriate to write library-related suggestions?
by Nicholas Tung 19 May '11

19 May '11

Hi all, I am curious if there is an avenue to make suggestions / comments about libraries? For example, "proc" in System.Process conflicts with the Arrows notation "proc", yielding confusing error messages. thanks, Nicholas — https://ntung.com — CS and Mathematics major @ UC Berkeley

2 2

For Euler 25; What is the first term in the Fibonacci sequence to contain 1000 digits?; the following seems to work.
by KC 19 May '11

19 May '11

For Euler 25; What is the first term in the Fibonacci sequence to contain 1000 digits?; the following seems to work. -- For number of digits being 5 or more. fibNdigits :: Int -> Int fibNdigits nDigits = floor (((fromIntegral nDigits) - 1.0) / (logBase 10 phi)) + 2 where sq5 = sqrt 5 :: Double phi = (1 + sq5) / 2 -- -- Regards, KC

2 1

Status of Haskell + Mac + GUIs & graphics
by Dummy 19 May '11

19 May '11

Hi, i am really happy about this lively discussion around Haskell (Mac) GUIs. I might hint to two other options: 1) Eclipse's SWT wraps the native platform's toolkits quite sucessfully. The platform-dependent bindings are mostly automatically generated, afaik. Some time ago i summarized my thoughts about extending SWT's infrastructure/code for Haskell here: http://www.reddit.com/r/haskell_proposals/comments/9w7nk/adjust_the_swt_bin… 2) Ruby's Shoes provides simple native wrappers as i've pointed out on Reddit: http://www.reddit.com/r/haskell/comments/he8pl/status_of_haskell_mac_guis_g… Bye, Lenny

1 0

Haskell Weekly News: Issue 182
by Daniel Santa Cruz 19 May '11

19 May '11

Welcome to issue 180 of the HWN, a newsletter covering developments in the Haskell community. This release covers the week of May 8 to 14, 2011. Announcements Eric Kow released the second edition of Parallel Haskell Digest [http://goo.gl/OXGIw] Don Stewart sent in a proposal from the Haskell.org committee to incorporate Haskell.org [http://goo.gl/X1j8i] Lazycat Manatee has released a new version of Manatee [http://goo.gl/vVTgy] Quotes of the Week * Richard O'Keefe: [On iterators and generators] This being Haskell, I'm expecting to see Cogenerator... * luqui: Haskell is a DSL for writing monad tutorials. * mattmight: Coq is a tool for turning ordinary programs into POPL papers. * kmc: most CS courses will teach you four kinds of Java * geheimdienst: haskell makes hard things easy and easy things a strong lax monoidal endofunctor ... * spoolio: Haskell programmers know the cost of nothing, the type of everything, and might know the value of a few things later. * catamorphism: FP is related to FP in the same way that UML is related to OOP. * geheimdienst: * geheimdienst will from now on use a function carpeTiem aliased to getCurrentTime * edwardk: [on data-accessor] However, its choice of internal representation makes me throw up in my mouth a little bit Top Reddit Stories * Fancy function graphs! Domain: pnyf.inf.elte.hu, Score: 47, Comments: 21 On Reddit: http://goo.gl/ibZO1 Original: http://goo.gl/24hQ6 * Online SVG figures with Haskell Domain: self.haskell, Score: 46, Comments: 11 On Reddit: http://goo.gl/jgxk4 * Erlang-in-Haskell: an implementation of an Erlang-like distributed computing framework for Haskell Domain: hackage.haskell.org, Score: 41, Comments: 2 On Reddit: http://goo.gl/yMMRG Original: http://goo.gl/eq6s3 * Why Eager Languages Don't Have Products and Lazy Languages Don't Have Sums Domain: james-iry.blogspot.com, Score: 38, Comments: 35 On Reddit: http://goo.gl/ngpNe Original: http://goo.gl/2O6yq * Introducing JsonGrammar Domain: martijn.van.steenbergen.nl, Score: 34, Comments: 2 On Reddit: http://goo.gl/wiGI9 Original: http://goo.gl/ns20k * The reasons I don't write all my code in Haskell Domain: codeflow.wordpress.com, Score: 33, Comments: 34 On Reddit: http://goo.gl/HMZ8c Original: http://goo.gl/hyuSa * Experimental GHC with GHCJS built in and Cabal support for JavaScript files Domain: article.gmane.org, Score: 30, Comments: 3 On Reddit: http://goo.gl/8zzZT Original: http://goo.gl/MQMvN * Two fun bits of Haskell teaching news Domain: serpentine.com.nyud.net, Score: 28, Comments: 3 On Reddit: http://goo.gl/JQUtF Original: http://goo.gl/mYz1q * Themes on Streams Domain: byorgey.wordpress.com, Score: 26, Comments: 1 On Reddit: http://goo.gl/ywP1K Original: http://goo.gl/ywPnl * CmdArgs - Fighting the GHC Optimiser Domain: neilmitchell.blogspot.com, Score: 20, Comments: 15 On Reddit: http://goo.gl/0WThF Original: http://goo.gl/CgCgz Top StackOverflow Questions * Safe execution of untrusted Haskell code votes: 19, answers: 2 http://goo.gl/9eHuc * When do I use ByteString and when do I not? votes: 16, answers: 2 http://goo.gl/vVQig * Why can I not make String an instance of a typeclass? votes: 14, answers: 3 http://goo.gl/Pn8DS * Android application in haskell votes: 11, answers: 1 http://goo.gl/UfnA1 * What are the most important abstractions in Haskell? Monads? Applicatives? votes: 9, answers: 3 http://goo.gl/RaXVQ About the Haskell Weekly News To help create new editions of this newsletter, please send stories to dstcruz(a)gmail.com. Until next time, Daniel Santa Cruz

1 0

ANNOUNCE: levmar-1.0
by Bas van Dijk 18 May '11

18 May '11

Dear all, I released levmar-1.0, an implementation of the Levenberg-Marquardt minimization algorithm that can be used for least squares, curve fitting and nonlinear programming. The most important change in this release is the use of vectors and matrices from the hmatrix package (which uses the high performance vector package). An application at work became 25 times faster when switching to the new levmar! I'm not sure this major speedup can be entirely attributed to the switch from lists to vectors. I also switched the FFI types from CDouble to Double in the internal bindings-levmar package. This made the expensive realToFrac conversions from CDouble to Double unnecessary which I believe had a big impact. API Documentation: http://hackage.haskell.org/package/levmar-1.0 I also switched the repository from darcs to git and hosted it on github: https://github.com/basvandijk/levmar/ Regards, Bas

1 0

ANNOUNCE: Haskell Communities and Activities Report (20th ed., May 2011)
by Janis Voigtländer 18 May '11

18 May '11

On behalf of all the contributors, I am pleased to announce that the Haskell Communities and Activities Report (20th edition, May 2011) is now available in PDF and HTML formats: http://haskell.org/communities/05-2011/report.pdf http://haskell.org/communities/05-2011/html/report.html Many thanks go to all the people that contributed to this report, both directly, by sending in descriptions, and indirectly, by doing all the interesting things that are reported. I hope you will find it as interesting a read as I did. If you have not encountered the Haskell Communities and Activities Reports before, you may like to know that the first of these reports was published in November 2001. Their goal is to improve the communication between the increasingly diverse groups, projects, and individuals working on, with, or inspired by Haskell. The idea behind these reports is simple: Every six months, a call goes out to all of you enjoying Haskell to contribute brief summaries of your own area of work. Many of you respond (eagerly, unprompted, and sometimes in time for the actual deadline ;-) to the call. The editor collects all the contributions into a single report and feeds that back to the community. When I try for the next update, six months from now, you might want to report on your own work, project, research area or group as well. So, please put the following into your diaries now: ========================================== End of October 2011: target deadline for contributions to the November 2011 edition of the HC&A Report ========================================== Unfortunately, many Haskellers working on interesting projects are so busy with their work that they seem to have lost the time to follow the Haskell related mailing lists and newsgroups, and have trouble even finding time to report on their work. If you are a member, user or friend of a project so burdened, please find someone willing to make time to report and ask them to "register" with the editor for a simple e-mail reminder in October (you could point me to them as well, and I can then politely ask if they want to contribute, but it might work better if you do the initial asking). Of course, they will still have to find the ten to fifteen minutes to draw up their report, but maybe we can increase our coverage of all that is going on in the community. Feel free to circulate this announcement further in order to reach people who might otherwise not see it. Enjoy! Janis Voigtlaender <hcar at haskell.org>

1 0

GPL, LGPL, and GHC Linking
by Jon Kristensen 18 May '11

18 May '11

Hello everyone! I just want to let you know that I have written a blog post about my thoughts about the issue of GHC linking and the General Public Licenses. I welcome any feedback or discussions around it. You can find the post at http://www.jonkristensen.com/gpl-lgpl-and-ghc-linking/. Warm regards, Jon Kristensen

1 0

Open CV or alternate image processing library for Haskell on windows?
by Gregory Guthrie 18 May '11

18 May '11

I wanted to look into using Haskell for an introductory Image Processing class, but the main package used for such things (OpenCV) does not appear to be available for windows systems. Is there some other good option for image processing in Haskell, or has anyone ported openCV to a windows Leksah environment? -------------------------------------------

5 9

Re: [Haskell-cafe] ANNOUNCE: iterIO-0.1 - iteratee-based IO with pipe operators
by Simon Marlow 18 May '11

18 May '11

On 12/05/2011 16:04, David Mazieres expires 2011-08-10 PDT wrote: > At Thu, 12 May 2011 09:57:13 +0100, > Simon Marlow wrote: >> >>> So to answer my own question from earlier, I did a bit of >>> benchmarking, and it seems that on my machine (a 2.4 GHz Intel Xeon >>> 3060, running linux 2.6.38), I get the following costs: >>> >>> 9 ns - return () :: IO () -- baseline (meaningless in itself) >>> 13 ns - unsafeUnmask $ return () -- with interrupts enabled >>> 18 ns - unsafeUnmask $ return () -- inside a mask_ >>> >>> 13 ns - ffi -- a null FFI call (getpid cached by libc) >>> 18 ns - unsafeUnmask ffi -- with interrupts enabled >>> 22 ns - unsafeUnmask ffi -- inside a mask_ >> >> Those are lower than I was expecting, but look plausible. There's room >> for improvement too (by inlining some or all of unsafeUnmask#). > > Do you mean inline unsafeUnmask, or unmaskAsyncExceptions#? I tried > inlining unsafeUnmask by writing my own version and giving it the > INLINE pragma, and it didn't affect performance at all. Right, I meant inlining unmaskAsyncExceptions#, which would require compiler support. >> However, the general case of unsafeUnmask E, where E is something more >> complex than return (), will be more expensive because a new closure for >> E has to be created. e.g. try "return x" instead of "return ()", and >> try to make sure that the closure has to be created once per >> unsafeUnmask, not lifted out and shared. > > Okay. I'm surprised by getpid example wasn't already stressing this, > but, indeed, I see a tiny difference with the following code: > > ffi>>= return . (1 +) -- where ffi calls getpid > > 13 ns - no unmasking > 20 ns - unsafeUnmask when not inside _mask > 25 ns - unsafeUnmask when benchmark loop in inside one big _mask > > So now we're talking about 28 cycles or something instead of 22. > Still not a huge deal. Ok, sounds reasonable. >> There are no locks here, thanks to the message-passing implementation we >> use for throwTo between processors. > > Okay, that sounds good. So then there is no guarantee about ordering > of throwTo exceptions? That seems like a good thing since there are > other mechanisms for synchronization. What kind of ordering guarantee did you have in mind? We do guarantee that in throwTo t e1 throwTo t e2 Thread t will receive e1 before e2 (obviously, because throwTo is synchronous and only returns when the exception has been raised). Pending exceptions are processed in LIFO order (for no good reason other than performance), so there's no kind of fairness guarantee of the kind you get with MVars. One thread doing throwTo can be starved by others. I don't think that's a serious problem. Cheers, Simon

4 12

Re: [Haskell-cafe] Is fusion overrated?
by Facundo Domínguez 18 May '11

18 May '11

> which is capable of producing elements one-by-one. So the whole thing > probably should run in constant space as well. Besides reducing the amount of GC calls, performance would also improve because the GC calls that remain are cheaper. The original program may run in constant space, but the fused program may use even a smaller constant space. Which in turn means that whenever the GC needs to make a pass, it is faster. Facundo

1 0

Is fusion overrated?
by Roman Cheplyaka 18 May '11

18 May '11

If one thinks about Haskell data structures as of ordinary data structures, fusion seems a great deal -- instead of producing intermediate lists and possibly running out of memory, we just run a loop and use constant amount of space. But Haskell data structures are quite different -- they are produced as demanded. Consider the example from the Stream Fusion paper[1]: f :: Int → Int f n = sum [ k ∗ m | k ← [1..n], m ← [1..k ] ] Assuming the sum is a strict left fold, it consumes elements of lists one-by-one and runs in constant space. The list part can be transformed to foldr (++) [] $ map (\k -> map (\m -> k*m) [1..k]) [1..n] which is capable of producing elements one-by-one. So the whole thing probably should run in constant space as well. Of course I don't claim that fusion is useless -- just trying to understand the problem it solves. Are we saving a few closures and cons cells here? [1] Stream Fusion. From Lists to Streams to Nothing at All. Duncan Coutts, Roman Leshchinskiy, Don Stewart. -- Roman I. Cheplyaka :: http://ro-che.info/ Don't worry what people think, they don't do it very often.

6 5

Haskell lib in non-Haskell program
by Eric Y. Kow 18 May '11

18 May '11

Hi all, I'd like to share my experiences packaging a Haskell program so that it can be used as a library by a non-Haskell application. I hope somebody might be able to (A) confirm that I'm doing the right thing or better still (B) suggest some corrections and/or simplifications. My objectives are: 1. For the non-Haskell application to use my library 2. ... without any Haskell infrastructure on the machine I think this means I want a shared library [1,2] although I'm a little bit fuzzy on the issue. I am not particularly concerned about the size of my executable or libraries. Including the Haskell RTS and my package deps is acceptable if that's what it takes to meet my primary and secondary objectives. I am targeting Windows and MacOS X. For Windows, my approach is to build a giant DLL with all the Haskell stuff statically linked in. For MacOS X I am using the `-dynamic` flag to compile all my dependencies (actually, I just set shared: True in cabal config) as well as the `-shared` flag. I am also now using GHC 7.0.3 with the latest (at the time of this writing) Haskell Platform (2011.2.0.1) [1] http://hackage.haskell.org/trac/ghc/wiki/SharedLibraries [2] http://www.haskell.org/ghc/docs/latest/html/users_guide/using-shared-libs.h… The whole thing ---------------------------------------------------------------------- You can see my efforts so far with darcs get --lazy http://code.haskell.org/GenI cd GenI cabal install cd geniwrapper make MacOS X users should be able to download http://erickow.com/tmp/MinimalGenI-OSX.tar.gz and run a test-mac.sh script which compiles a program with GCC using GenI, runs it and outputs some JSON string. Exposing some C functions and using them ---------------------------------------------------------------------- So far, I think I know how to expose some of library as C functions and to compile a little program written in C that uses this library. ghc --make -fvia-C MinimalGenI # provides some C functions via FFI exports ghc -c StartEnd.c # http://www.haskell.org/ghc/docs/latest/html/users_guide/win32-dlls.html ghc test-c.c MinimalGenI.o MinimalGenI_stub.o StartEnd.o\ -package GenI -package utf8-string\ -o test-c.o I notice that -fvia-C is going away, but I'm going to ignore this fact for now and assume/hope that doing without it will be easy Building a Windows shared library ---------------------------------------------------------------------- As I understand it, it is possible to build a Windows DLL, albeit one containing the Haskell RTS and all my Haskell libraries statically linked in. Users can download the DLL and link it to their Visual Basic programs without having to touch GHC. The extra work involved looks like this: ghc MinimalGenI.o MinimalGenI_stub.o StartEnd.o\ -package GenI -package utf8-string\ -shared -o MinimalGenI.dll ghc test-c.c MinimalGenI.dll -o test-c2 Note that building test-c.c with ghc does not meet my second objective of being able to combine Haskell lib with non-Haskell program sans Haskell infrastructure. However, I think I know how to do it for MacOS X and that the procedure would be more or less the same. I have not looked into it. [3] http://www.haskell.org/ghc/docs/latest/html/users_guide/win32-dlls.html Building a MacOS X shared library ---------------------------------------------------------------------- For MacOS X, I would almost like to generate a gigantic file like the Windows DLL. But maybe that's the wrong thing to want. I do almost exactly the same thing, except that instead of distributing a single giant file, I track down a whole bunch of dependencies and copy over the dylib files for them. Note that as a prerequisite, this requires reinstalling a lot of packages with --enable-shared (I just edit ~/.cabal/config and set shared to True). ghc MinimalGenI.o MinimalGenI_stub.o StartEnd.o\ -package GenI -package utf8-string\ -dynamic -shared -o MinimalGenI.dylib ghc test-c.c MinimalGenI.dylib -o test-c2 As an alternative to building with GHC, I can compile test-c.c and link with MinimalGenI.dylib directly with GCC. It's a little bit hairy. What I did was to run ghc with -v3 to see what gcc commands it was running, clean them up and package them in a script (test-mac.sh attached). It's a little bit voodoo-ish, a lot of flags that I don't really understand the significance of, and some libraries I'm not 100% clear on why I need the static versions for. Also I find it slightly odd that I can't seem to just merge the first two steps of the process, producing/assembling assembly code for test.c. In any case, it seems to work... Packaging the MacOS X shared library ---------------------------------------------------------------------- I'm trying to distribute my Haskell library in a way that does not require the user to install anything beyond XCode. To do this, I track down the dynamic libraries for all the packages I'm using and their dependencies. Unfortunately, the way I did it was basically trial and error (find all dylib and hand remove the ones that seem totally irrelevant; get a friend to test it on a raw machine). Rather than the dumb approach used in the attached dist-mac.sh, it should be relatively easy to write a small Haskell script to recurse down the package dependency tree and tell me exactly which files I need to copy. Maybe such a tool exists already. If this procedure is right, and if somebody should write such a script (maybe already part of the cabal-macosx package?) then I bet creating app bundles for your MacOS X Haskell GUI tools should be quite straightforward as well. Thanks for reading! -- Eric Kow <http://erickow.com>

1 0

Random thoughts about typeclasses
by Robert Clausecker 18 May '11

18 May '11

Hello! I found out, that GHC implements typeclasses as an extra argument, a record that stores all functions of the typeclass. So I was wondering, is there a way (apart from using newtype) to pass a custom record as the typeclass record, to modify the behavior of the typeclass? I thought about something like this: f :: Show a => [a] -> String f = (>>= show) -- So, f becomes something like this? __f :: ClassShow a -> [a] -> String __f (ClassShow __show) x = x >>= __show -- And if I call the function, it looks somewhat like this: g :: [Int] -> String g = f __g = __f instanceShowInt -- But is it possible to do something like this? g2 = __f (ClassShow (return . fromEnum)) Tis is just a random thought, some compilers like JHC implement them by another way. But would this theoretically be possible? Yours, FUZxxl

4 3

Exception for NaN
by Grigory Sarnitskiy 18 May '11

18 May '11

How do I make my program stop whenever it gets somewhere NaN as a result during a calculation? If there is no appropriate flag for ghc maybe there exist flags for C to use in optc. I don't want NaN to propagate, it is merely stupid, it should be terminated.

13 19

Re: [Haskell-cafe] why doesn't ghc give you a type signature that works ?
by Ivan Lazar Miljenovic 18 May '11

18 May '11

(Re-CC-ing the list) On 18 May 2011 15:16, <briand(a)aracnet.com> wrote: > On Wed, 18 May 2011 13:52:46 +1000 > Ivan Lazar Miljenovic <ivan.miljenovic(a)gmail.com> wrote: > >> What's happening is that the type involves the FFTWReal class. >> However, this isn't immediately visible to ghci as it isn't in scope, >> but it can figure out that it's found in Math.FFT.Base. As such, you >> need to import that module as well (as opposed to just the Math.FFT >> class you have already imported). >> > > Well now, that makes perfect sense doesn't it ? > > I think my problem is that I think if I import the top-level module then the sub-modules should also be visible, provided I use the full name, or in the case of a qualified name, something link FFT.Base.FFTWReal. > > Clearly this is not the case, but why not ? Is it just the convention that haskell chose, or is there a reason for it ? Consider Data.ByteString vs Data.ByteString.Lazy; the have the exact same API but for completely different types. Also, it's quite often for package foo to have module Data.Foo, and then module bar extends it with module Data.Foo.Bar; should importing Data.Foo also bring in Data.Foo.Bar? What happens if bar isn't installed? -- Ivan Lazar Miljenovic Ivan.Miljenovic(a)gmail.com IvanMiljenovic.wordpress.com

1 0

why doesn't ghc give you a type signature that works ?
by briand＠aracnet.com 18 May '11

18 May '11

for example: I will ask the glorious compiler, and it says: *Main> :t calcFFT calcFFT :: (Math.FFT.Base.FFTWReal r) => V.Vector (Complex r) -> V.Vector (Complex r) I then put the signature in my code, reload it, and: Not in scope: type constructor or class `Math.FFT.Base.FFTWReal' It seems very strange to me that the fully qualified module name doesn't work, nor does any combination thereof, e.g. FFT.FFTWReal, FFT.Base.FFTWReal, etc... I'm importing FFT as: import qualified Math.FFT as FFT I'm not sure if that causes the problem. Generally speaking this happens to me quite a lot, and I've never tried to understand what's going on, because the signature is not required. I've decided to try now :-) Obviously I'll need some help. Thanks, Brian

4 3

fishing for ST mutable Vector examples
by brad clawsie 18 May '11

18 May '11

hi all i was wondering if anyone could post some minimal examples on using mutable Vectors in the ST monad. i've been digging around in the usual places but haven't been able to find anything to get me over the hump thanks in advance brad

8 10

opening windows on a mac via ghci?
by Conal Elliott 18 May '11

18 May '11

Has anyone figured out a way to get libraries that open windows to work with ghci? With libraries like glut I get the body of a window, but no frame, and the process wedges. I guess the problem has to do with lack of .app bundle. If so, perhaps a work-around might involve running ghci in an app bundle--though I'm just speculating from vast ignorance. - Conal

2 1

ANNOUNCE: preview release of diagrams EDSL for declarative drawing
by Brent Yorgey 17 May '11

17 May '11

I am extremely pleased to announce a "developer preview" release of the diagrams framework [1] for declarative drawing. This is a well-thought-out, well-documented, working release with all core functionality in place, but with many planned features still missing (for example, support for rendering text and higher-level tools for constructing curves). If you are interested in - trying out a new way of producing vector graphics, - providing feedback to help drive ongoing development, or - getting involved and contributing some code yourself, please give it a try! On the other hand, if you are looking for a complete, full-featured package that will let you jump right into producing the graphics you need, you may want to wait for the 1.0 release. If you are familiar with the diagrams package [2] already on Hackage, this is a complete rewrite which has been in the works for over a year and a half. What is it? ----------- Diagrams is an embedded domain-specific library (EDSL) for creating diagrams, illustrations, and other sorts of vector graphics. The overall vision is for diagrams to become a viable alternative to systems like MetaPost, Asymptote, and PGF/TikZ. Diagrams is: - Declarative: you specify what a diagram is, not how to draw it. - Compositional: diagrams can be combined in many ways to produce more complex diagrams. Diagrams are scale- and translation-invariant, so you never have to worry about a "global" coordinate system, only "local" ones. - Embedded: the full power of Haskell, including every library on Hackage, is available to help construct and manipulate diagrams. - Extensible: extending diagrams with additional or higher-level functionality is as simple as writing a Haskell module. - Flexible: diagrams is designed from the ground up to be as generic and flexible as possible. Features include: - Pluggable rendering backends -- creating a new rendering backend is as simple as writing a type class instance. - Arbitrary vector spaces -- the core diagrams library data types and primitives work for any vector space, so given a suitable rendering backend you can produce diagrams of any dimension, or even more exotic things... Cool, how can I try it out? --------------------------- Start by reading the quick tutorial [3], which has detailed information about how to install the necessary packages and will introduce you to the fundamentals of the framework. Or, for the truly impatient: cabal install diagrams-core diagrams-lib diagrams-cairo How can I contribute? --------------------- There are lots of ways you can contribute! First, you may want to subscribe to the project mailing list [4], and/or come hang out in the #diagrams IRC channel on freenode.org. - Cairo is the only well-supported backend at the moment, but you might create another backend or contribute to an existing project [5]. - The standard library is in need of additional features. Visit the Google Code site [6] for a list of open tickets. - Create a higher-level module built on top of the diagrams framework (e.g. tree or graph layout, generating Turing machine configuration diagrams, Penrose tilings ... your imagination is the only limit!) and submit it for inclusion in a special diagrams-contrib package which will be created for such higher-level user-contributed modules. - Use diagrams to create some cool graphics and submit them for inclusion in a gallery of examples (to be created soon). - Start your own project built on top of diagrams and let us know how it goes! - Last but certainly not least, just try it out for your pet graphics generation needs and contribute your bug reports and feature requests. Happy diagramming! Brought to you by the diagrams team: - Brent Yorgey - Ryan Yates with contributions from: - Sam Griffin - Vilhelm Sjöberg - Luite Stegeman - Kanchalai Suveepattananont - Scott Walck [1] http://code.google.com/p/diagrams/ [2] http://hackage.haskell.org/package/diagrams [3] http://projects.haskell.org/diagrams/tutorial/DiagramsTutorial.html [4] http://groups.google.com/group/diagrams-discuss [5] http://code.google.com/p/diagrams/wiki/BackendProjects [6] http://code.google.com/p/diagrams/

3 3

I cannot find the module Data.Numbers.Primes
by KC 17 May '11

17 May '11

-- -- Regards, KC

3 3

Master Thesis on Haskell
by Burak Ekici 17 May '11

17 May '11

Dear All, I am planning to write a master thesis project on the monadic programming manner of Haskell PL. What I want to kindly ask you is that if you have enough time and patience which can be shared with me, could you please have a quick look at the attached outline for the project I intend to write. Your ideas and comments are valuable for me and I would be very appreciated if you share them. Thanks a lot and best of regards, Burak Ekici.

1 1

Options to reduce memory use (Shootout Benchmark)
by Thorsten Hater 17 May '11

17 May '11

Hello, over the weekend I played a little with the fasta benchmark at the shootout site. I tried to understand the current submission and decided to build my own version. Astonishingly, after some tuning its quite fast (<1sec on my machine, when the current entry use ~11sec) but uses quite some memory (~11MB). Basically you have to use a custom pseudo random number generator to build strings of randomized DNA by choosing from a given probability distribution. Is there some way to reduce memory consumption? 11MB seems quite a lot. Thorsten {-# LANGUAGE BangPatterns #-} module Main where import System.Environment import qualified Data.ByteString.Lazy as L import qualified Data.ByteString.Lazy.Char8 as C (pack, take) import qualified Data.ByteString as S data P = P !Char !Float type LUT = [P] alu = C.pack "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ \GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ \CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ \ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ \GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ \AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ \AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" iubs, homs :: LUT iubs = cdf [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02) ,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02) ,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)] homs = cdf [('a',0.3029549426680),('c',0.1979883004921) ,('g',0.1975473066391),('t',0.3015094502008)] -- compile LUT from assoc list cdf :: [(Char,Float)] -> LUT cdf ls = reverse $! cdf' [] 0 ls where cdf' acc _ [] = acc cdf' acc c ((v,k):ls) = cdf' ((P v c'):acc) c' ls where !c' = k + c -- extract Char from List by Key choose :: LUT -> Float -> Char choose lut !f = choose' lut where choose' ((P v k):ls)| f <= k = v | otherwise = choose' ls -- PRNG im, ia, ic :: Int im = 139968 ia = 3877 ic = 29573 data R = R !Float !Int imd :: Float imd = fromIntegral im rand :: Int -> R rand seed = R newran newseed where newseed = (seed * ia + ic) `rem` im newran = (fromIntegral newseed) / imd -- /PRNG -- Cache all possible results cache :: LUT -> L.ByteString cache ls = C.pack $! reverse $! go [v] s where (R !f !s) = rand 42 -- if we arrive at Seed 42, we completed one cycle, STOP !v = choose ls f go :: String -> Int -> String go acc 42 = acc go acc !q = go (v':acc) s' where (R !f' !s') = rand q !v' = choose ls f' -- FASTA writer from current entry fasta n s = do let (t:ts) = L.toChunks s go ts t n where go ss s n | n == 0 = return () | l60 && n60 = S.putStrLn l >> go ss r (n-60) | n60 = S.putStr s >> S.putStrLn a >> go (tail ss) b (n-60) | n <= ln = S.putStrLn (S.take n s) | otherwise = S.putStr s >> S.putStrLn (S.take (n-ln) (head ss)) where ln = S.length s l60 = ln >= 60 n60 = n >= 60 (l,r) = S.splitAt 60 s (a,b) = S.splitAt (60-ln) (head ss) main = do n <- getArgs >>= readIO . head putStrLn ">ONE Homo sapiens alu" fasta (n*2) $! L.cycle alu putStrLn ">TWO IUB ambiguity codes" fasta (n*3) (L.cycle $! cache $! iubs) putStrLn ">THREE Homo sapiens frequency" fasta (n*5) (L.drop (fromIntegral (n*3) `mod` 139968) $! L.cycle $! cache homs)

1 0

Accelerate package (CUDA). How to actually create an array?
by Grigory Sarnitskiy 17 May '11

17 May '11

Hello! I'm probing CUDA with Haskell, accelerate package to be exact. Sound stupid, but I couldn't find how to actually construct an array, for example Vector Float. There is quite a number of examples provided with the package, but they seem not simple enough for me just to start.

4 4

Inconsistent window updates with SDL library
by Michael Serra 17 May '11

17 May '11

Greetings Haskellers, I'm relatively new to the language and I'm writing a basic game of life simulation to try out the SDL bindings. The program updates the window with the next generation of cells each time you press 'n', and the problem I'm finding is that every so often the window stops updating. The program continues; refreshing the window (by moving it, say) updates it to the correct current state. I thought there must be a big problem with my code, but found the same behavior with lesson 20<https://github.com/snkkid/LazyFooHaskell>of the SDL lazyfoo tutorials (the animation test). Can anyone explain what is causing this? I hope to hear I've made some obvious mistake, rather than discover any limitation with the useful SDL bindings..

2 2

generic putback
by Sergey Mironov 17 May '11

17 May '11

Hi Cafe. I wonder if it is possible to write a IO putback function with following interface putback :: a -> IO a -> IO a putback x io = ??? where io is some action like reading from file or socket. I want putback to build new action which will return x on first call, and continue executing io after that. Thanks in advance! Sergey.

3 3

ErrorT vs Either
by Gracjan Polak 17 May '11

17 May '11

Hi all, A why question: Why: Control.Monad.Error Prelude> runErrorT (fail "msg") :: IO (Either String Int) Left "msg" but Control.Monad.Error Prelude> (fail "msg") :: (Either String Int) *** Exception: msg ? -- Gracjan

6 9

>>= definition for list monad in ghc
by Michael Vanier 16 May '11

16 May '11

Usually in monad tutorials, the >>= operator for the list monad is defined as: m >>= k = concat (map k m) -- or concatMap k m but in the GHC sources it's defined as: m >>= k = foldr ((++) . k) [] m As far as I can tell, this definition is equivalent to the previous one (correct me if I'm wrong), so I was wondering why this definition was chosen instead of the other one. Does anybody know? Thanks in advance, Mike

6 9