Re: [Haskell-cafe] A tale of three shootout entries

27 Nov 2007

      Simon Peyton-Jones wrote:
...
| Something I found with Dons version on my machine was that if I removed
| all the exclamation marks and the -fbang-patterns bit at the top it went
| about 20% faster as well as being much cleaner code, but with my very
| rudimentary understanding of Haskell I wasn't entirely sure it would
| produce the same results if I did this and didn't get round to checking.
If, after investigation (and perhaps checking with Don) you find that adding bangs makes your program go slower, even though the function is in fact strict (otherwise it might go slower because it's just doing more work!) then I'd love to see a test case.
Sorry, I don't understand the code, I've jumped in the deep-end before
learning to swim, but I can now tell you it's producing the same results
when I remove some of the exclamation marks. I've checked with an MD5 on
the output.

The timings in seconds for 10,000,000 iterations averaged over 5 runs.
(There was quite a bit of variation.) Compiled with GHC 6.6.1. (I got
stuck compiling it under 6.8) The fancy compile options are from the
shootout page.

Dons original program      13.26    compiled ghc --make
Dons original program      12.54    compiled with -O -fglasgow-exts
                                        -optc-mfpmath=sse -optc-msse2
                                        -optc-march=pentium4
Removed 3 bangs from rand  11.47    compiled ghc --make
Removed 3 bangs from rand  11.57    compiled with -O -fglasgow-exts
                                        -optc-mfpmath=sse -optc-msse2
                                        -optc-march=pentium4

The code below is Dons program from

http://shootout.alioth.debian.org/gp4/benchmark.php?test=fasta&lang=ghc&id=0

with a timing function added by me. The rand function is where I removed
three exclamation marks to make the program faster. Previously I removed
different combinations of bangs. Some bangs seem to make it faster and
some seem to make it slower.

Richard.

------------------------------------------------------------------
{-# OPTIONS -O2 -optc-O2 -optc-ffast-math -fbang-patterns 
-fexcess-precision #-}
--
-- The Computer Language Benchmarks Game
-- http://shootout.alioth.debian.org/
--
-- Contributed by Don Stewart
-- A lazy bytestring solution.
--
-- Add:
-- -optc-mfpmath=sse -optc-msse2
--

import System
import Data.Word
import Control.Arrow

import Text.Printf     -- RK added.
import System.CPUTime  -- RK added.

import qualified Data.ByteString.Lazy as L
import qualified Data.ByteString.Lazy.Char8 as C (pack,unfoldr)
import qualified Data.ByteString as S
import Data.ByteString.Base

-- RK added this time function.
time :: IO t -> IO t
time a = do
     start <- getCPUTime
     v <- a
     end   <- getCPUTime
     let diff = (fromIntegral (end - start)) / (10 ^12)
     printf "Calc time %0.3f \n" (diff :: Double)
     return v

main = do         -- RK modified main to time the computation.
     time $ comp   -- RK mod.

comp :: IO Int    -- RK mod.
comp = do         -- RK mod. This was Dons main. I just renamed to comp.
     n <- getArgs >>= readIO . head
     writeFasta  "ONE"   "Homo sapiens alu"       (n*2) (L.cycle alu)
     g <- unfold "TWO"   "IUB ambiguity codes"    (n*3) (look iubs) 42
     unfold      "THREE" "Homo sapiens frequency" (n*5) (look homs) g

------------------------------------------------------------------------
--
-- lazily unfold the randomised dna sequences
--

unfold l t n f !g = putStrLn (">" ++ l ++ " " ++ t) >> unroll f g n

unroll :: (Int -> (Word8, Int)) -> Int -> Int -> IO Int
unroll f = loop
     where
         loop r 0   = return r
         loop !r !i = case S.unfoldrN m (Just . f) r of
                         (!s, Just r') -> do
                             S.putStrLn s
                             loop r' (i-m)
           where m = min i 60

look ds !k = let (d,j) = rand k in (choose ds d, j)

choose :: [(Word8,Float)] -> Float -> Word8
choose [(b,_)]       _ = b
choose ((!b,!f):xs) !p = if p < f then b else choose xs (p-f)

------------------------------------------------------------------------
--
-- only demand as much of the infinite sequence as we require

writeFasta label title n s = do
      putStrLn $ ">" ++ label ++ " " ++ title
      let (t:ts) = L.toChunks s
      go ts t n
   where
      go ss !s !n
         | l60 && n60 = S.putStrLn l               >> go ss        r (n-60)
         |        n60 = S.putStr s >> S.putStrLn a >> go (tail ss) b (n-60)
         | n <= ln    = S.putStrLn (S.take n s)
         | otherwise  = S.putStr s >> S.putStrLn (S.take (n-ln) (head ss))
         where
             !ln   = S.length s
             !l60  = ln >= 60
             !n60  = n  >= 60
             (l,r) = S.splitAt 60 s
             (a,b) = S.splitAt (60-ln) (head ss)

------------------------------------------------------------------------

im  = 139968
ia  = 3877
ic  = 29573

rand :: Int -> (Float, Int)
rand seed = (newran,newseed)                 -- RK modified. Was !seed
     where
         newseed = (seed * ia + ic) `rem` im  -- RK mod. Was !newseed
         newran  =  1.0 * fromIntegral newseed / imd  -- RK. Was !newran
         imd      = fromIntegral im

------------------------------------------------------------------------

alu = C.pack
         "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\
         \GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\
         \CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\
         \ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\
         \GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
         \AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
         \AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"

iubs = map (c2w *** id)
         [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02)
         ,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02)
         ,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)]

homs = map (c2w *** id)
         [('a',0.3029549426680),('c',0.1979883004921)
         ,('g',0.1975473066391),('t',0.3015094502008)]

Re: [Haskell-cafe] A tale of three shootout entries

Richard Kelsall