This time I have tried fasta benchmark since current entries does notdisplay correct output.Program is copy of mine http://benchmarksgame.alioth.debian.org/u64q/program.php?test=fasta&lang=gpp&id=1c++ benchmark, but unfortunately executes more than twice time. Seems to me that culprit is in function random as I have tested rest of codeand didn't found speed related problems. bmaxa@maxa:~/shootout/fasta$ time ./fastahs 25000000 > /dev/null real 0m5.262suser 0m5.228ssys 0m0.020s bmaxa@maxa:~/shootout/fasta$ time ./fastacpp 25000000 > /dev/null real 0m2.075suser 0m2.056ssys 0m0.012s Since I am planning to contribute program, perhaps someone cansee a problem to speed it up at least around 3.5 secs which is speed of bench that display incorrect result (in 7.6.1). Program follows: {-# LANGUAGE BangPatterns #-}{- The Computer Language Benchmarks Game http://shootout.alioth.debian.org/ contributed by Branimir Maksimovic-} import System.Environmentimport System.IO.Unsafe import Data.IORefimport Data.Array.Unboxedimport Data.Array.Storableimport Data.Array.Baseimport Data.Word import Foreign.Ptrimport Foreign.C.Types type A = UArray Int Word8type B = StorableArray Int Word8type C = (UArray Int Word8,UArray Int Double) foreign import ccall unsafe "stdio.h" puts :: Ptr a -> IO ()foreign import ccall unsafe "string.h" strlen :: Ptr a -> IO CInt main :: IO () main = do n <- getArgs >>= readIO.head let !a = (listArray (0,(length alu)-1) $ map (fromIntegral. fromEnum) alu:: A) make "ONE" "Homo sapiens alu" (n*2) $ Main.repeat a (length alu) make "TWO" "IUB ambiguity codes" (n*3) $ random iub make "THREE" "Homo sapiens frequency" (n*5) $ random homosapiens make :: String -> String -> Int -> IO Word8 -> IO (){-# INLINE make #-}make id desc n f = do let lst = ">" ++ id ++ " " ++ desc a <- (newListArray (0,length lst) $ map (fromIntegral. fromEnum) lst:: IO B) unsafeWrite a (length lst) 0 pr a make' n 0 where make' :: Int -> Int -> IO () make' !n !i = do let line = (unsafePerformIO $ newArray (0,60) 0 :: B) if n > 0 then do !c <- f unsafeWrite line i c if i+1 >= 60 then do pr line make' (n-1) 0 else make' (n-1) (i+1) else do unsafeWrite line i 0 l <- len line if l /= 0 then pr line else return () pr :: B -> IO ()pr line = withStorableArray line (\ptr -> puts ptr)len :: B -> IO CIntlen line = withStorableArray line (\ptr -> strlen ptr) repeat :: A -> Int -> IO Word8repeat xs !n = do let v = unsafePerformIO $ newIORef 0 !i <- readIORef v if i+1 >= n then writeIORef v 0 else writeIORef v (i+1) return $ xs `unsafeAt` i random :: C -> IO Word8random (a,b) = do !rnd <- rand let find :: Int -> IO Word8 find !i = let !c = a `unsafeAt` i !p = b `unsafeAt` i in if p >= rnd then return c else find (i+1) find 0 rand :: IO Double{-# INLINE rand #-}rand = do !seed <- readIORef last let newseed = (seed * ia + ic) `rem` im newran = fromIntegral newseed * rimd rimd = 1.0 / (fromIntegral im) im, ia, ic :: Int im = 139968 ia = 3877 ic = 29573 writeIORef last newseed return newran where last = unsafePerformIO $ newIORef 42 alu :: [Char] alu = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ \GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ \CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ \ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ \GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ \AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ \AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" mkCum :: [(Char,Double)] -> [(Word8,Double)]mkCum lst = map (\(c,p) -> ((fromIntegral.fromEnum) c,p)) $ scanl1 (\(_,p) (c',p') -> (c', p+p')) lst homosapiens, iub :: C iub' = mkCum [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02) ,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02) ,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)] homosapiens' = mkCum [('a',0.3029549426680),('c',0.1979883004921) ,('g',0.1975473066391),('t',0.3015094502008)] iub = (listArray (0, (length iub')-1) $ map fst iub', listArray (0, (length iub')-1) $ map snd iub') homosapiens = (listArray (0, (length homosapiens')-1) $ map fst homosapiens', listArray (0, (length homosapiens')-1) $ map snd homosapiens')