- Haskell-Cafe - Haskell.org

why doesn't ghc give you a type signature that works ?
by briand＠aracnet.com 18 May '11

18 May '11

for example: I will ask the glorious compiler, and it says: *Main> :t calcFFT calcFFT :: (Math.FFT.Base.FFTWReal r) => V.Vector (Complex r) -> V.Vector (Complex r) I then put the signature in my code, reload it, and: Not in scope: type constructor or class `Math.FFT.Base.FFTWReal' It seems very strange to me that the fully qualified module name doesn't work, nor does any combination thereof, e.g. FFT.FFTWReal, FFT.Base.FFTWReal, etc... I'm importing FFT as: import qualified Math.FFT as FFT I'm not sure if that causes the problem. Generally speaking this happens to me quite a lot, and I've never tried to understand what's going on, because the signature is not required. I've decided to try now :-) Obviously I'll need some help. Thanks, Brian

4 3

fishing for ST mutable Vector examples
by brad clawsie 18 May '11

18 May '11

hi all i was wondering if anyone could post some minimal examples on using mutable Vectors in the ST monad. i've been digging around in the usual places but haven't been able to find anything to get me over the hump thanks in advance brad

8 10

opening windows on a mac via ghci?
by Conal Elliott 17 May '11

17 May '11

Has anyone figured out a way to get libraries that open windows to work with ghci? With libraries like glut I get the body of a window, but no frame, and the process wedges. I guess the problem has to do with lack of .app bundle. If so, perhaps a work-around might involve running ghci in an app bundle--though I'm just speculating from vast ignorance. - Conal

2 1

ANNOUNCE: preview release of diagrams EDSL for declarative drawing
by Brent Yorgey 17 May '11

17 May '11

I am extremely pleased to announce a "developer preview" release of the diagrams framework [1] for declarative drawing. This is a well-thought-out, well-documented, working release with all core functionality in place, but with many planned features still missing (for example, support for rendering text and higher-level tools for constructing curves). If you are interested in - trying out a new way of producing vector graphics, - providing feedback to help drive ongoing development, or - getting involved and contributing some code yourself, please give it a try! On the other hand, if you are looking for a complete, full-featured package that will let you jump right into producing the graphics you need, you may want to wait for the 1.0 release. If you are familiar with the diagrams package [2] already on Hackage, this is a complete rewrite which has been in the works for over a year and a half. What is it? ----------- Diagrams is an embedded domain-specific library (EDSL) for creating diagrams, illustrations, and other sorts of vector graphics. The overall vision is for diagrams to become a viable alternative to systems like MetaPost, Asymptote, and PGF/TikZ. Diagrams is: - Declarative: you specify what a diagram is, not how to draw it. - Compositional: diagrams can be combined in many ways to produce more complex diagrams. Diagrams are scale- and translation-invariant, so you never have to worry about a "global" coordinate system, only "local" ones. - Embedded: the full power of Haskell, including every library on Hackage, is available to help construct and manipulate diagrams. - Extensible: extending diagrams with additional or higher-level functionality is as simple as writing a Haskell module. - Flexible: diagrams is designed from the ground up to be as generic and flexible as possible. Features include: - Pluggable rendering backends -- creating a new rendering backend is as simple as writing a type class instance. - Arbitrary vector spaces -- the core diagrams library data types and primitives work for any vector space, so given a suitable rendering backend you can produce diagrams of any dimension, or even more exotic things... Cool, how can I try it out? --------------------------- Start by reading the quick tutorial [3], which has detailed information about how to install the necessary packages and will introduce you to the fundamentals of the framework. Or, for the truly impatient: cabal install diagrams-core diagrams-lib diagrams-cairo How can I contribute? --------------------- There are lots of ways you can contribute! First, you may want to subscribe to the project mailing list [4], and/or come hang out in the #diagrams IRC channel on freenode.org. - Cairo is the only well-supported backend at the moment, but you might create another backend or contribute to an existing project [5]. - The standard library is in need of additional features. Visit the Google Code site [6] for a list of open tickets. - Create a higher-level module built on top of the diagrams framework (e.g. tree or graph layout, generating Turing machine configuration diagrams, Penrose tilings ... your imagination is the only limit!) and submit it for inclusion in a special diagrams-contrib package which will be created for such higher-level user-contributed modules. - Use diagrams to create some cool graphics and submit them for inclusion in a gallery of examples (to be created soon). - Start your own project built on top of diagrams and let us know how it goes! - Last but certainly not least, just try it out for your pet graphics generation needs and contribute your bug reports and feature requests. Happy diagramming! Brought to you by the diagrams team: - Brent Yorgey - Ryan Yates with contributions from: - Sam Griffin - Vilhelm Sjöberg - Luite Stegeman - Kanchalai Suveepattananont - Scott Walck [1] http://code.google.com/p/diagrams/ [2] http://hackage.haskell.org/package/diagrams [3] http://projects.haskell.org/diagrams/tutorial/DiagramsTutorial.html [4] http://groups.google.com/group/diagrams-discuss [5] http://code.google.com/p/diagrams/wiki/BackendProjects [6] http://code.google.com/p/diagrams/

3 3

I cannot find the module Data.Numbers.Primes
by KC 17 May '11

17 May '11

-- -- Regards, KC

3 3

Master Thesis on Haskell
by Burak Ekici 17 May '11

17 May '11

Dear All, I am planning to write a master thesis project on the monadic programming manner of Haskell PL. What I want to kindly ask you is that if you have enough time and patience which can be shared with me, could you please have a quick look at the attached outline for the project I intend to write. Your ideas and comments are valuable for me and I would be very appreciated if you share them. Thanks a lot and best of regards, Burak Ekici.

1 1

Options to reduce memory use (Shootout Benchmark)
by Thorsten Hater 17 May '11

17 May '11

Hello, over the weekend I played a little with the fasta benchmark at the shootout site. I tried to understand the current submission and decided to build my own version. Astonishingly, after some tuning its quite fast (<1sec on my machine, when the current entry use ~11sec) but uses quite some memory (~11MB). Basically you have to use a custom pseudo random number generator to build strings of randomized DNA by choosing from a given probability distribution. Is there some way to reduce memory consumption? 11MB seems quite a lot. Thorsten {-# LANGUAGE BangPatterns #-} module Main where import System.Environment import qualified Data.ByteString.Lazy as L import qualified Data.ByteString.Lazy.Char8 as C (pack, take) import qualified Data.ByteString as S data P = P !Char !Float type LUT = [P] alu = C.pack "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ \GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ \CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ \ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ \GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ \AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ \AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" iubs, homs :: LUT iubs = cdf [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02) ,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02) ,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)] homs = cdf [('a',0.3029549426680),('c',0.1979883004921) ,('g',0.1975473066391),('t',0.3015094502008)] -- compile LUT from assoc list cdf :: [(Char,Float)] -> LUT cdf ls = reverse $! cdf' [] 0 ls where cdf' acc _ [] = acc cdf' acc c ((v,k):ls) = cdf' ((P v c'):acc) c' ls where !c' = k + c -- extract Char from List by Key choose :: LUT -> Float -> Char choose lut !f = choose' lut where choose' ((P v k):ls)| f <= k = v | otherwise = choose' ls -- PRNG im, ia, ic :: Int im = 139968 ia = 3877 ic = 29573 data R = R !Float !Int imd :: Float imd = fromIntegral im rand :: Int -> R rand seed = R newran newseed where newseed = (seed * ia + ic) `rem` im newran = (fromIntegral newseed) / imd -- /PRNG -- Cache all possible results cache :: LUT -> L.ByteString cache ls = C.pack $! reverse $! go [v] s where (R !f !s) = rand 42 -- if we arrive at Seed 42, we completed one cycle, STOP !v = choose ls f go :: String -> Int -> String go acc 42 = acc go acc !q = go (v':acc) s' where (R !f' !s') = rand q !v' = choose ls f' -- FASTA writer from current entry fasta n s = do let (t:ts) = L.toChunks s go ts t n where go ss s n | n == 0 = return () | l60 && n60 = S.putStrLn l >> go ss r (n-60) | n60 = S.putStr s >> S.putStrLn a >> go (tail ss) b (n-60) | n <= ln = S.putStrLn (S.take n s) | otherwise = S.putStr s >> S.putStrLn (S.take (n-ln) (head ss)) where ln = S.length s l60 = ln >= 60 n60 = n >= 60 (l,r) = S.splitAt 60 s (a,b) = S.splitAt (60-ln) (head ss) main = do n <- getArgs >>= readIO . head putStrLn ">ONE Homo sapiens alu" fasta (n*2) $! L.cycle alu putStrLn ">TWO IUB ambiguity codes" fasta (n*3) (L.cycle $! cache $! iubs) putStrLn ">THREE Homo sapiens frequency" fasta (n*5) (L.drop (fromIntegral (n*3) `mod` 139968) $! L.cycle $! cache homs)

1 0

Accelerate package (CUDA). How to actually create an array?
by Grigory Sarnitskiy 17 May '11

17 May '11

Hello! I'm probing CUDA with Haskell, accelerate package to be exact. Sound stupid, but I couldn't find how to actually construct an array, for example Vector Float. There is quite a number of examples provided with the package, but they seem not simple enough for me just to start.

4 4

Inconsistent window updates with SDL library
by Michael Serra 17 May '11

17 May '11

Greetings Haskellers, I'm relatively new to the language and I'm writing a basic game of life simulation to try out the SDL bindings. The program updates the window with the next generation of cells each time you press 'n', and the problem I'm finding is that every so often the window stops updating. The program continues; refreshing the window (by moving it, say) updates it to the correct current state. I thought there must be a big problem with my code, but found the same behavior with lesson 20<https://github.com/snkkid/LazyFooHaskell>of the SDL lazyfoo tutorials (the animation test). Can anyone explain what is causing this? I hope to hear I've made some obvious mistake, rather than discover any limitation with the useful SDL bindings..

2 2

generic putback
by Sergey Mironov 17 May '11

17 May '11

Hi Cafe. I wonder if it is possible to write a IO putback function with following interface putback :: a -> IO a -> IO a putback x io = ??? where io is some action like reading from file or socket. I want putback to build new action which will return x on first call, and continue executing io after that. Thanks in advance! Sergey.

3 3